AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                         <---------ANAC58                                            <---------ARR11(2)
                         <---------ANAC46                                            --------->ARR11(3)
                         ----------->GT1                                             --------->AGP1
                  --------------->AGL15                                              --------->RVE1(2)
                  <---------------AGL15                                 --------->RVE1(2)
               --------->ARR11(2)                                       --------->GATA12
               <---------ARR11(2)                                       <---------ARR11(3)
               --------->ARR14(2)                                ----------->GT1     <---------GATA12
               <---------ARR14(2)                            --------->GLK1(2)       --------->ARR11(2)
               --------->RVE1(2)            <---------ZAT18  ------->TEIL            --------->GATA12
           ------>ZmHOX2a(1)                <---------ZAT14 --------->ARR11(3)  --------->STY1(2)  <
      --------->KAN1 xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)   --------->ARR14(2)------>ZmHOX2a(1) <---
    <---------DOF5.7(1)  <---------ANAC58   --------->ZAT18 <---------ARR14(2)===============HOX2a_HOX2a
------->DOF2  ------>ZmHOX2a(1) --------->KAN1       <------ZmHOX2a(1)  --------->ARR11(3)  <-------
taaagtctcttatcctcctatccacattgagtgaaacatgcctagagtgctcatgaggatgaagaacctggttaaaatctcctagcaagatccaaggtct  13332000
                       <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                <---------ARR14(2)
                    --------->AtMYB61                                      <----------TaMYB80
               --------->At4g35610                                         --------->KAN1
               <---------HSFC1(2)                                         ---------->TaMYB80
              --------->ANAC58  ------>ZmHOX2a(2)                  --------->WRKY38(1)
         --------->LBD16      --------->ARR11(3)             xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
       <---------LBD16 <xxxxxxxxxxxxxxxxsmallRNA(i)          xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
    ----------->HVH21---------->DOF2                      --------->YAB1xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)                    <---------YAB5--------->RAP2.6(2)
---------->DOF2--------->HSFC1(2)              <----------DOF2     --------->WRKY12
---------AHL20(2) -------->P --------->ZAT14  <---------DOF5.7(1) <---------MYB52(1)
------WOX13(2)--------->ANAC58<---------ARR11(3)     <---------DOF5.7(1)<------NtERF2        -------
--ARR11(3)<---------------------WRI1   <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)<---------KAN1 <xxxxxxxxx
attaaaagtgaccggagaagctaccaaagcagtgatctctctccataactcttttctcttatcatcttcgttggccgcatataccacagagataacaatc  13332100
                                                                --------->AtMYB61     ------->GAMYB
                                                                --------->TOE2(3)  xxxxxxxxxxxxxxxxx
                                                              -------->P         <xxxxxxxxxxxxxxxxxx
                                            --------->ATHB12  xxxxxxxxxxxxxxxx>smallRNA(i)  <-------
                                    <---------At4g35610      ------->GAMYB       <xxxxxxxxxxxxxxxxxx
                                  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)      --------->PCF2 --------
                                 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)       <---------TCP15(1)
                        --------->ANAC58   <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)  <xxxxxxxxxxxxxxxxxx
                        --------->ANAC58 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)  <xxxxxxxxxxxxxxxxxxx
                        --------->ANAC46 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)  <xxxxxxxxxxxxxxxxxxx
                       xxxxxxxxxxxxxxxx>smallRNA(s) ----------->RAV1(1)     --------->TCP15(1)
                    ------->TEIL <---------YAB5     <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)    --------
                   --------->ARR14(2)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)  <---------PCF2 <--------
                   <---------GLK1(2)--------->At4g35610     --------->MYB46(3)  <xxxxxxxxxxxxxxxxxxx
                 --------->DOF5.7(1)----------->RAV1(2)   --------->YAB1    <-----------HVH21      <
        <---------KAN1<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3) <---------MYB111(2) <xxxxxxxxxxxxxxxxxxx
-->RVE1(2)     ---------->DOF2 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3) xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
xxxxxxxxxxxxxxsmallRNA(i2)xxxxxxxxxxxxxxxx>smallRNA(s) --------->YAB1--------->MYB46(3)    xxxxxxxxx
caagtgcgagaattagggaaaagaacctcgcaagtgatcatctgcaacgatttggcaacaataacaacctcaacagatgggtcccataacacccatatct  13332200
   <---------GATA12                                                                 ------->MYC2
   --------->RVE1(2)                                                                <-------MYC4
   --------->GATA12                                                                 <-------PIF5
  <---------CCA1(2)                                                                 ------->MYC3
 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)                                             <---------ANAC58
 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)                                             --------->ANAC55(2)
xxxxxxxxxxxxxxxsmallRNA(fl3)                                                       --------->TGA1a
->ARR14(2)                                                                         <---------TGA1a
--ARR14(2)                                                                         <---------ANAC58
--ARR11(3)                                                                     ==============bZIP_DOF
->ARR11(3)                                  <---------At4g35610                <----------DOF2
--ARR11(1)                                  --------->At4g35610               <---------ANAC58
xxxxx>smallRNA(le3)                         <---------ZAT2                    <---------ANAC58
xxxxxsmallRNA(le3)                          --------->ZAT2                 <--------P
xxxxsmallRNA(fl3)                           <------NtERF2                  ==================MYC_MYB
----ARR10                                  ----------->RAV1(1)            xxxxxxxxxxxxxxxx>smallRNA(i)
xxxsmallRNA(s)                           <xxxxxxxxxxxxxxxxsmallRNA(s)     ===================MYC_MYB
xxxxxsmallRNA(si3)                       <xxxxxxxxxxxxxxxxsmallRNA(i)   <---------AtMYB61          <
->RVE1(2)                               --------->ANAC46               <---------MYB52(1)          <
xxxxsmallRNA(se3)                   ------>MYB46(1)       <-----------GT1 <---------ANAC58         -
xxxsmallRNA(le3)                    -------->P         <---------AHL12(2) <-------GAMYB           --
xxxxsmallRNA(si3)         xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)       <----------DOF2  <---------ANAC58
->ARR11(2)                <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)        =======================bZIP_DOF
-CCA1(2)      --------->TOE2(3)   --------->AtMYB61    --------->WOX13(2) <---------ANAC58        --
xxxsmallRNA(fl3)          <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)       ------>ZmHOX2a(1)<---------ANAC58
xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)------>MYB83       <---------WOX13(2)<---------MYB46(3)    -----
xxxxsmallRNA(se3)       <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)      ---------->ID1  <---------ANAC55(2)
xxxxxxxxxxxxxx>smallRNA(le3)     --------->MYB46(3)   --------->YAB1xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
tccctaaatctgagaaaccatagttctcatcaaaaaaccaaccaggcagcagagcattaataaacttcttgtcctttggttgcttcacgtgcttctctat  13332300
                                                             ----------->GT1             --------->AHL25(3)
                                                             <---------KAN1              --------->AHL25(2)
                                                    --------->YAB5                       <---------AHL20(1)
   ----------------->AGL3                        --------->YAB5                    *TSS  <---------AHL12(1)
  ------>NtERF2                                 <---------YAB1----------->GT1      ----------->RAV1(1)
---------ATERF1(1)                           <---------ARR11(2)               --------->KAN4(2)    <
---------RAP2.3(1)                           --------->ARR11(2)              --------->HSFB2a(1) ---
----->NtERF2                                 <---------MYB52(1)              --------->KAN1    -----
------->ANAC58                        ---------->DOF2     <------ZmHOX2a(1)  <---------HSFB2a(1) <--
------->ANAC58         --------->TOE1(3)    <---------RAP2.6(3)            <------ZmHOX2a(1)   <----
------>HVH21           --------->TOE2(3)------------>MYB.PH3(1)       --------->AtMYB61  --------->AHL12(1)
gacgcctccaaaaataggcctattgaccttaaaccattttttaaagccgttacgatgactaggaatgttaaaaccacaggacattccaacaaaaaatttg  13332400
      <---------AHL20(2)                                                        --------->ZAT14
      --------->AHL20(3)                                                        <---------ZAT14
      <---------AHL20(3)      --------->HSFB2a(2)                        --------->AtMYB61
---------ZAT14                <---------HSFB2a(2)                    <-------TEIL
------>ZAT14  --------->TOE2(3)                     --------->KAN1 --------->GATA12
---------->AtSPL8         <----------DOF2       <-----------GT1    <---------ARR14(2)
-------ZAT18  --------->TOE1(3)       --------->ARR11(3)           --------->ARR14(2)             <-
-----------AtSPL8    --------->YAB5   <---------ARR11(3)           <---------GLK1(2)<----------DOF2
tgtacacatattaatgaccttaaaccattctttatagaagagaccttgattttacttactcttgctccaagattcaccaaaactacactttctcaatact  13332500
                  <---------ARR11(3)                                      --------->ANAC58
          <---------ICU4   ------>NtERF2                                  --------->bZIP60(2)
          --------->YAB5  --------->LBD16    <------MYB83       <---------WOX13(1)
         --------------->AGL15    >>>>>>>>>ARR2               --------->ATHB12
         <---------------AGL15  <---------YAB1 --------->WRKY18(1)        --------->ANAC58
         <---------YAB5  --------->HSFB2a(2) <------MYB46(1)  --------->YAB5          --------->TOE1(2)
      <-----------GT1<----------DOF2        --------->MYB59<---------At4g35610      ------->TEIL
  --------->AHL20(2)--------->HSFB2a(1)   <---------MYB52(1) <---------YAB1----------->RAV1(1)------
--------YAB5  ---------->DOF2   <---------TOE2(3)--------->WOX13(1)       --------->ANAC46   <------
agtcattttatactcattaaagaactttcccgactaagattgtctgtttggtcaatctatttagatgattggattccacgacatatgtaccagcgagtga  13332600
  <---------DOF5.7(1)               --------->ARR14(2)                                      <-------
 <---------DOF5.7(1)                --------->ARR11(2)                                    ------>NtERF2
 <----------DOF2  <---------MYB46(3)<---------MYB52(1)                                 <---------At4g35610
 --------------->AGL15              <---------ARR11(2)                             --------->ANAC58
 <---------------AGL15              <---------ARR14(2)        <---------ICU4       --------->ANAC58
<-----------------AGL3     <---------AHL20(2)                 --------->YAB1    <---------ZAT2   ---
<---------DOF5.7(1) <---------ARR11(2) <---------YAB1        <---------YAB5     --------->ZAT2   <--
=================MADS_MADS <-----------GT1  <---------TOE2(3)<---------ATHB12   <---------At4g35610
--->KAN1         <---------AtMYB61--------->LBD16     --------->ZAT18           --------->At4g35610
---KAN1     ----------->RAV1(2) <---------LBD16       <---------ZAT18        <--------P--------->At4g35610
tgctctttttttggtacctggtggttctatttacttccggttatgttaagaattttgtgaactaatcatgttttttttgggttagctcgcctctgccgtg  13332700
     ----------->HVH21                                                        --------->AHL20(2)   -
--ANAC46                                                                      --------->AHL25(1)  --
--ANAC58                                                                      --------->AHL25(3) <--
--ANAC58                                                                      <---------AHL25(1) <--
------>HSFB2a(2)                                           --------->YAB5 <---------TOE2(3)     <---
-------HSFB2a(2)     <---------ZAT6          <---------RVE1(2)     <-------TEIL<---------AHL20(3)---
ctcgaagtctgactggtttggctagagttactgaaacagagtttatttgctattgtttaaaatgtttaggctcatctaagattaatttaggttgaactaa  13332800
                            --------->AHL20(2)                                           ------>ZmHOX2a(2)
                            <---------AHL20(2)                                          <------ZmHOX2a(2)
                            <---------AHL25(3)                                         --------->AGP1
                           <---------AHL25(2)                                          --------->GATA12
                           --------->AHL20(1)                                          --------->ARR14(3)
                           --------->AHL25(2)                                          <---------ARR14(2)
                           <---------AHL25(1)                                          --------->ARR14(2)
   --------->LBD16         --------->AHL20(2)                                          <---------ARR14(3)
   ------>ZmHOX2a(1)       <---------AHL20(1)                                          --------->ARR11(3)
  <---------LBD16          <---------AHL20(2)                                          <---------ARR11(3)
 ----------->RAV1(2)       --------->AHL20(3)                                          <---------GATA12
-------->ARR11(3)          --------->AHL25(1)                   ----------->GT1        <---------RVE1(2)
------->KAN1               <---------AHL20(3)          <--------P                     --------->GLK1(1)
-------ARR11(3)            --------->AHL25(3)        <------MYB83                     <---------GLK1(1)
-------AHL20(1)          <---------WOX13(2)          <------MYB46(1)             <------NtERF2 <----
------KAN1    <---------TOE2(3)--------->ICU4       <---------AtMYB61           <xxxxxxxxxxxxxxxxsmallRNA(le3)
------>ARR11(3)          --------->WOX13(2)         --------->MYB111(1)         <xxxxxxxxxxxxxxxxxxx
tatatcctggagagtttatggatgaactaatttaataatgagtatcaaatatgagttggtagataaacagtagaaaactaaggcctcagagatcttggtg  13332900
<- Previous    Next ->

AGI:  At4g26360.1   
Description:  transposable element gene. non-LTR retrotransposon family (LINE), has a 4.9e-40 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus)
Range:  from: 13328772    to: 13332384    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At4g26365.1   
Description:  snoRNA. snoRNA
Range:  from: 13332843    to: 13332920    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version