AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                      <------ZmHOX2a(2)
                                                                                      --------->CCA1(2)
                                                                                     <---------ARR11(3)
                                                                                     --------->ARR14(2)
                                                                                     <---------ARR14(2)
                         <---------ANAC58                                            <---------ARR11(2)
                         <---------ANAC46                                            --------->ARR11(3)
                         ----------->GT1                                             --------->AGP1
                  --------------->AGL15                                              --------->RVE1(2)
                  <---------------AGL15                                 --------->RVE1(2)
               --------->ARR11(2)                                       --------->GATA12
               <---------ARR11(2)                                       <---------ARR11(3)
               --------->ARR14(2)                                ----------->GT1     <---------GATA12
               <---------ARR14(2)                            --------->GLK1(2)       --------->ARR11(2)
               --------->RVE1(2)            <---------ZAT18  ------->TEIL            --------->GATA12
           ------>ZmHOX2a(1)                <---------ZAT14 --------->ARR11(3)  --------->STY1(2)  <
      --------->KAN1 xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)   --------->ARR14(2)------>ZmHOX2a(1) <---
    <---------DOF5.7(1)  <---------ANAC58   --------->ZAT18 <---------ARR14(2)===============HOX2a_HOX2a
------->DOF2  ------>ZmHOX2a(1) --------->KAN1       <------ZmHOX2a(1)  --------->ARR11(3)  <-------
 
taaagtctcttatcctcctatccacattgagtgaaacatgcctagagtgctcatgaggatgaagaacctggttaaaatctcctagcaagatccaaggtct  13332000
                                                                                ----------->RAV1(1)
                                                                             <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                                            --------->ARR14(2)
                                                                            <---------ARR11(2)
                       <xxxxxxxxxxxxxxxxsmallRNA(i)                         <---------ARR14(2)
                    --------->AtMYB61                                      <---------KAN1
               --------->At4g35610                                         <----------TaMYB80
               <---------HSFC1(2)                                         ---------->TaMYB80
              --------->ANAC58  ------>ZmHOX2a(2)                  --------->WRKY12
         --------->LBD16      --------->ARR11(3)             xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
       <---------LBD16 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3) xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
    ----------->HVH21---------->DOF2                      --------->YAB1xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
---------->DOF2--------->HSFC1(2)                        <---------YAB5--------->RAP2.6(2)
xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)          <----------DOF2     --------->WRKY38(1)
---------AHL20(2) -------->P --------->ZAT14  <---------DOF5.7(1) <---------MYB52(1)
------WOX13(2)--------->ANAC58<---------ARR11(3)     <---------DOF5.7(1)<------NtERF2        -------
--ARR11(3)<---------------------WRI1   <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)--------->KAN1 <xxxxxxxxx
 
attaaaagtgaccggagaagctaccaaagcagtgatctctctccataactcttttctcttatcatcttcgttggccgcatataccacagagataacaatc  13332100
                                                                                            <xxxxxxx
                                                                                            --------
                                                                                            <-------
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                                                                --------->AtMYB61     ------->GAMYB
                                                                --------->TOE2(3)  xxxxxxxxxxxxxxxxx
                                                                --------->TOE1(3)<xxxxxxxxxxxxxxxxxx
                                                               xxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                                              -------->P         <xxxxxxxxxxxxxxxxxx
                                            --------->ATHB12  xxxxxxxxxxxxxxxx>smallRNA(i)  <-------
                                    ============================RAV----------->RAV1(1)<xxxxxxxxxxxxx
                                    ----------->RAV1(2)      ------->GAMYB       <xxxxxxxxxxxxxxxxxx
                                  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)      --------->PCF2 --------
                                 <---------YAB5     ----------->RAV1(1)      <---------TCP15(1)
                        --------->ANAC58   <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)  <xxxxxxxxxxxxxxxxxx
                        --------->ANAC58 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)  <xxxxxxxxxxxxxxxxxxx
                        --------->ANAC46 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)  <xxxxxxxxxxxxxxxxxxx
                       xxxxxxxxxxxxxxxx>smallRNA(s) <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)    --------
                    ------->TEIL <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)      --------->TCP15(1)
                   <---------GLK1(2)--------->At4g35610     --------->MYB46(3)  <xxxxxxxxxxxxxxxxxxx
                   --------->ARR14(2)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)  <---------PCF2 <--------
                 --------->DOF5.7(1)<---------At4g35610   --------->YAB1    <-----------HVH21      <
        <---------KAN1<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3) <---------MYB111(2) <xxxxxxxxxxxxxxxxxxx
-->RVE1(2)     ---------->DOF2 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3) xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
xxxxxxxxxxxxxxsmallRNA(i2)xxxxxxxxxxxxxxxx>smallRNA(s) --------->YAB1--------->MYB46(3)    xxxxxxxxx
 
caagtgcgagaattagggaaaagaacctcgcaagtgatcatctgcaacgatttggcaacaataacaacctcaacagatgggtcccataacacccatatct  13332200
                                                                                    ------->MYC3
                                                                                    <-------PIF4
                                                                                    ------->PIF4
                                                                                    <-------MYC3
                                                                                    <-------MYC4
                                                                                    <-------MYC2
   <---------GATA12                                                                 ------->MYC4
   --------->RVE1(2)                                                                ------->MYC2
   --------->GATA12                                                                 ------->PIF5
  <---------CCA1(2)                                                                 <-------PIF5
 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)                                             --------->ANAC55(2)
 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)                                             <---------ANAC58
xxxxxxxxxxxxxxxsmallRNA(fl3)                                                       --------->TGA1a
->ARR14(2)                                                                         <---------TGA1a
--ARR14(2)                                                                         <---------ANAC58
--ARR11(3)                                                                     ==============bZIP_DOF
->ARR11(3)                                  <---------At4g35610                <----------DOF2
--ARR11(1)                                  --------->At4g35610               <---------ANAC58
xxxxx>smallRNA(le3)                         <---------ZAT2                    <---------ANAC58
xxxxxsmallRNA(le3)                          <------NtERF2                  ==================MYC_MYB
xxxxsmallRNA(fl3)                           --------->ZAT2                 <--------P
----ARR10                                  ----------->RAV1(1)            xxxxxxxxxxxxxxxx>smallRNA(i)
xxxsmallRNA(s)                           <xxxxxxxxxxxxxxxxsmallRNA(s)     <---------ANAC58         <
xxxxxsmallRNA(si3)                       <xxxxxxxxxxxxxxxxsmallRNA(i)   <---------AtMYB61          <
->RVE1(2)                               --------->ANAC46               <---------MYB52(1)          -
xxxxsmallRNA(se3)                   ------>MYB46(1)       <-----------GT1 ===================MYC_MYB
xxxsmallRNA(le3)                    ------>MYB83       <---------WOX13(2) <---------ANAC58        --
xxxxsmallRNA(si3)         <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)        ------>ZmHOX2a(1)           --
->ARR11(2)                xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)       =======================bZIP_DOF
xxxsmallRNA(fl3)          <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)       <----------DOF2  <---------ANAC58
-CCA1(2)      --------->TOE2(3)   --------->AtMYB61    <---------AHL12(2) <-------GAMYB<---------ANAC58
xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)-------->P         --------->WOX13(2)<---------MYB46(3)    -----
xxxxsmallRNA(se3)       <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)      ---------->ID1  <---------ANAC55(2)
xxxxxxxxxxxxxx>smallRNA(le3)     --------->MYB46(3)   --------->YAB1xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
 
tccctaaatctgagaaaccatagttctcatcaaaaaaccaaccaggcagcagagcattaataaacttcttgtcctttggttgcttcacgtgcttctctat  13332300
                                                                                          <---------AHL12(1)
                                                                                          <---------AHL12(2)
                                                                                          <---------AHL12(3)
                                                                                          --------->AHL25(2)
                                                                                          <---------AHL25(2)
                                                                                          <---------AHL25(3)
                                                                                          --------->AHL12(1)
                                                                                         <---------AHL25(2)
                                                                                         --------->AHL25(1)
                                                                                         <---------AHL20(2)
                                                                                         --------->AHL20(2)
                                                             ----------->GT1             --------->AHL25(3)
                                                             <---------KAN1              --------->AHL25(2)
                                                    --------->YAB5                       <---------AHL20(1)
   ----------------->AGL3                        --------->YAB5                    ----------->RAV1(1)
  ------>NtERF2                                 <---------YAB1----------->GT1      *TSS  <---------AHL12(1)
---------ATERF1(1)                           <---------MYB52(1)               --------->KAN4(2)    <
---------RAP2.3(1)                           --------->ARR11(2)              --------->KAN1    -----
----->NtERF2                                 <---------ARR11(2)              --------->HSFB2a(1) ---
------->ANAC58                        ---------->DOF2     <------ZmHOX2a(1)  <---------HSFB2a(1) <--
------->ANAC58         --------->TOE1(3)    <---------RAP2.6(3)            <------ZmHOX2a(1)   <----
------>HVH21           --------->TOE2(3)------------>MYB.PH3(1)       --------->AtMYB61  --------->AHL12(1)
 
gacgcctccaaaaataggcctattgaccttaaaccattttttaaagccgttacgatgactaggaatgttaaaaccacaggacattccaacaaaaaatttg  13332400
        <---------ICU4
        --------->YAB1
      <---------AHL20(2)                                                        --------->ZAT14
      --------->AHL20(3)                                                        <---------ZAT14
      <---------AHL20(3)      --------->HSFB2a(2)                        --------->AtMYB61
---------ZAT14                <---------HSFB2a(2)                    <-------TEIL
---------->AtSPL8         <----------DOF2           --------->KAN1 --------->GATA12
------>ZAT14  --------->TOE1(3)                 <-----------GT1    <---------ARR14(2)
-------ZAT18  --------->TOE2(3)       --------->ARR11(3)           --------->ARR14(2)             <-
-----------AtSPL8    --------->YAB5   <---------ARR11(3)           <---------GLK1(2)<----------DOF2
 
tgtacacatattaatgaccttaaaccattctttatagaagagaccttgattttacttactcttgctccaagattcaccaaaactacactttctcaatact  13332500
                                  <---------GLK1(2)
                                  >>>>>>>>>ARR1
                    --------->HSFB2a(1)
                    <---------HSFC1(2)
                    --------->HSFC1(2)
                  --------->ARR11(3)
                  <---------ARR11(3)                                      --------->ANAC58
          <---------ICU4   ------>NtERF2                                  --------->ANAC46
          --------->YAB5  --------->LBD16    <------MYB83       <---------WOX13(1)
         --------------->AGL15    >>>>>>>>>ARR2               --------->YAB5
         <---------------AGL15  <---------TOE2(3)--------->WOX13(1)       --------->ANAC58
         <---------YAB5  --------->HSFB2a(2) <------MYB46(1)  --------->ATHB12        --------->TOE1(2)
         ===========================================================================================
      <-----------GT1<----------DOF2        --------->MYB59<---------At4g35610      ------->TEIL
  --------->AHL20(2)<---------HSFB2a(1)   <---------MYB52(1) <---------YAB1----------->RAV1(1)------
--------YAB5  ---------->DOF2   <---------YAB1 --------->WRKY18(1)        --------->bZIP60(2)<------
 
agtcattttatactcattaaagaactttcccgactaagattgtctgtttggtcaatctatttagatgattggattccacgacatatgtaccagcgagtga  13332600
                                                                                            <-------
                                                                                            <-------
  <---------DOF5.7(1)               <---------ARR14(2)                                      <-------
 --------------->AGL15              <---------ARR11(2)                                    ------>NtERF2
 <---------------AGL15              <---------MYB52(1)                                 <---------At4g35610
 <---------DOF5.7(1)                --------->ARR11(2)                             --------->ANAC58
 <----------DOF2  <---------MYB46(3)--------->ARR14(2)        <---------ICU4       --------->ANAC58
<-----------------AGL3     <---------AHL20(2)                 --------->YAB1    <---------ZAT2   <--
<---------DOF5.7(1) <---------ARR11(2) <---------YAB1        <---------YAB5     <---------At4g35610
=================MADS_MADS <-----------GT1  <---------TOE2(3)<---------ATHB12   --------->At4g35610
--->KAN1         <---------AtMYB61--------->LBD16     --------->ZAT18           --------->ZAT2   ---
---KAN1     ----------->RAV1(2) <---------LBD16       <---------ZAT18        <--------P--------->At4g35610
 
tgctctttttttggtacctggtggttctatttacttccggttatgttaagaattttgtgaactaatcatgttttttttgggttagctcgcctctgccgtg  13332700
                                                                                    --------->MYB59
                                                                                    <---------TOE2(3)
                                                                                    <---------TOE1(3)
                                                                                --------->WOX13(2)
                                                                                <---------WOX13(2)
                                                                                <---------AHL12(2)
                                                                               <---------AHL25(3)
                                                                               --------->AHL20(3)
                                                                               --------->AHL25(1)
                                                                               <---------AHL20(2)
                                                                               <---------AHL12(3)
                                                                              <---------AHL12(1)
                                                                              --------->AHL12(1)
                                                                              --------->AHL20(2)
     ----------->HVH21                                                        <---------AHL20(2)   -
--ANAC58                                                                      --------->AHL25(3)  --
--ANAC58                                                                      <---------AHL25(1) <--
--ANAC46                                                                      --------->AHL25(1) <--
-------HSFB2a(2)                                           --------->YAB5 <---------TOE2(3)     <---
------>HSFB2a(2)     <---------ZAT6          <---------RVE1(2)     <-------TEIL<---------AHL20(3)---
 
ctcgaagtctgactggtttggctagagttactgaaacagagtttatttgctattgtttaaaatgtttaggctcatctaagattaatttaggttgaactaa  13332800
                                       --------->RVE1(2)
                                   --------->YAB5
                                  --------->ICU4
                                  <---------YAB5
                                  <---------YAB1
                                <---------ICU4
                                --------->YAB1
                                -------->HAHB4
                               <---------ATHB51
                             --------->YAB1
                            --------->AHL20(2)                                           ------>ZmHOX2a(2)
                            <---------AHL20(2)                                          <------ZmHOX2a(2)
                            <---------AHL25(3)                                         --------->GATA12
                           <---------AHL25(2)                                          --------->AGP1
                           --------->AHL20(1)                                          --------->ARR14(3)
                           --------->AHL25(2)                                          <---------ARR14(3)
                           <---------AHL25(1)                                          <---------ARR14(2)
   ------>ZmHOX2a(1)       --------->AHL20(2)                                          --------->ARR14(2)
   --------->LBD16         <---------AHL20(1)                                          --------->ARR11(3)
  <---------LBD16          <---------AHL20(2)                                          <---------ARR11(3)
 ----------->RAV1(2)       --------->AHL20(3)                                          <---------RVE1(2)
-------->ARR11(3)          --------->AHL25(1)                   ----------->GT1        <---------GATA12
------->KAN1               <---------AHL20(3)          <--------P                     <---------GLK1(1)
-------AHL20(1)            --------->AHL25(3)        <------MYB83                     --------->GLK1(1)
-------ARR11(3)          --------->WOX13(2)          <------MYB46(1)             <------NtERF2 <----
------KAN1    <---------TOE2(3)--------->ICU4       --------->MYB111(1)         <xxxxxxxxxxxxxxxxxxx
------>ARR11(3)          <---------WOX13(2)         <---------AtMYB61           <xxxxxxxxxxxxxxxxsmallRNA(le3)
 
tatatcctggagagtttatggatgaactaatttaataatgagtatcaaatatgagttggtagataaacagtagaaaactaaggcctcagagatcttggtg  13332900
<- Previous    Next ->

AGI:  At4g26360.1   
Description:  transposable element gene. non-LTR retrotransposon family (LINE), has a 4.9e-40 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus)
Range:  from: 13328772    to: 13332384    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g26365.1   
Description:  snoRNA. snoRNA
Range:  from: 13332843    to: 13332920    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version