AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
  --------->KAN1
 <---------RVE1(2)                       <---------WOX13(2)
--------WOX13(1)               ----------->RAV1(1)                                <----------DOF2
----->YAB1                    --------->MYB46(3)            ---------->DOF2      <---------DOF5.7(1)
-----YAB1        ------>ZmHOX2a(1)------->GAMYB      --------->ZAT6    --------->ZAT6
 
gatggatattagaactgttcctgctagataacaacaacagagctaatttcacatcaacactaaaaaagcttcttacagtagaactctttacatgttcaga  8677800
                  <---------YAB1
                  --------->GLK1(2)
                --------->KAN1
               <---------RVE1(2)
         --------->AHL12(1)
      <--------ATHB1               <---------At5g28300
      --------->YAB5         ------>MYB83
      --------->YAB1         ------>MYB46(1)
     <---------YAB1         ----------->RAV1(1)                           ---------->DOF2
     --------->ICU4         ------------>AtMYB77                 --------->ANAC58
     <---------ATHB12       --------->MYB52(1)            --------->REM1(1) ----------->GT1
     <---------YAB5       --------->MYB46(3)  --------->KAN1     --------->ANAC58            <------
 
caaaaacaatgattttttgatattcttgaaccaacagttacagtcatctatatgctatgctacatttcaagcatgtagaaagtagaaacccatagtataa  8677900
                                --------->DAG2
                          --------->ANAC58
                 <---------ICU4--------->ICU4                        --------->TOE1(2)    --------->WOX13(1)
    --------->GLK1(2)     --------->ANAC46                          --------->MYB46(3)  <---------ATHB12
   <---------GLK1(2)  --------->ANAC46 <---------At4g35610      --------->ANAC58       --------->RVE1(2)
  --------->KAN1 --------->ARR14(2)    --------->At4g35610      --------->ANAC58  --------->ANAC46
 <---------RVE1(2)   <---------LBD16---------->DOF2        <---------YAB1         --------->ANAC58
---YAB1 ------>ZmHOX2a(1) --------->ANAC58           <---------TOE2(3)            --------->ANAC58
 
ttcagagattcctgattcaatatttgcgcaagcaaaaattgaagcagacaaacattttggttatgacaagaaccagcgagaaaacacacaaatcaatcta  8678000
                                                                                 --------->TOE2(2)
                                                                                 --------->TOE1(2)
                                       -------->HAHB4                           --------->ANAC55(2)
                                       --------->YAB1                           <---------ANAC55(2)
                                       --------->YAB5                          <---------TOE1(3)
                                <---------TOE2(3)                       <---------KAN1    <---------ANAC58
                              ---------->DOF2 >>>>>>>>>RAP2.2          --------->WOX13(2) <---------ANAC58
                             --------->MYB46(3)             --------->LBD16    <---------TOE2(3)
                             <---------MYB52(2)            <---------ANAC58   --------->MYB52(1)
                           ----------->RAV1(1)--------->TOE2(3)   --------->RVE1(2)    --------->DOF5.7(1)
                          <----------ID1   --------->WOX13(1)   --------->KAN1<---------DOF5.7(2)
       --------->YAB5<---------ICU4   --------->ICU4       <---------ANAC58 <---------MYB52(2)
      <---------YAB5--------->ICU4    <---------YAB1       <---------ANAC46--------->At4g35610
----------->GT1     <---------YAB1    <---------YAB5      <---------LBD16  <---------At4g35610
 
agttagtgaatcactctctcgtcaatattgcaacaaaggtaatgatcaatctaaaacaacttgcgggaaaatcgaattagctaacgtaagaaggcgagca  8678100
                                                        <---------ANAC58
                                               <-------TEIL
                                              --------->ARR14(1)
                                              --------->CCA1(2)
                                             <---------ARR14(2)
                                             --------->ARR11(1)
                                             <---------RVE1(2)
                                             <---------ARR11(2)                    <---------KAN1
                                             --------->ARR14(2)               <------NtERF2
          --------->WRKY38(1)     --------->ARR14(2)    <---------ANAC58    <---------DEAR3(1)
      <-------TEIL        <---------KAN1     --------->ARR11(2)            <---------LBD16
    --------->ARR14(2)   <---------KAN4(2)  --------->CCA1(2)              ------>ZmHOX2a(1)    <---
<-----------GT1     ---------->DOF2   <---------HSFB2a(2)            --------->KAN1----------->HVH21
 
gtttcacgattcgttgatcacagtaaagaataaacacgattcgagagagatacgattttgcttactagcttcaaattcctcggcgaatgacatttgggaa  8678200
                                                    --------->KAN1
                                        <---------AHL20(2)
                                        <---------AHL12(3)
                <---------ARR14(2)     <---------AHL25(1)
                --------->ARR11(2)     <---------AHL20(3)
                --------->ARR14(2)     <---------AHL20(2)
                <---------ARR11(2)     <---------ARR11(3)
       ----------------->AG            --------->AHL20(2)
       --------------->AGL15           <---------AHL20(1)
       <---------------AGL15           --------->ARR11(3)
       ----------------->AGL1          --------->AHL20(1)
      <-----------------AGL2           --------->AHL20(3)
      ----------------->AGL3           <---------AHL25(3)
      ----------------->AGL2           <---------AHL12(1)
      <-----------------AGL3           --------->AHL25(1)
      ----------------->AGL1           --------->AHL12(1)             <---------DOF5.7(1)
      <-----------------AG             --------->AHL25(3)            <---------DOF5.7(1)
      ----------------->AG             --------->AHL25(2)            <----------DOF2
      <-----------------AGL1           <---------AHL25(2)           <---------DOF5.7(1)
   --------->GLK1(1)                  --------->AHL12(2)            <---------DAG2
   <---------GLK1(1)      *TSS ---------->DOF2    --------->YAB1 <-----------GT1          --------->ZAT18
<---------TOE1(3)  <-----------RAV1(1)--------->AHL12(3)     <---------YAB1               <---------ZAT18
<---------TOE2(3)<---------GLK1(1)    --------->AHL25(1) <----------DOF2                 <---------ANAC46
------KAN1      <---------RVE1(2)     <---------AHL12(3)<---------DOF5.7(1)         <------------CBF
 
tttagggtttcccaaaatggatatgttgcaaaatgaaagaaatatatttgcagtaatactctttatttttgcctttttcttattttgtattggcgcacaa  8678300
                                                                                                  --
                                                                                                ----
                                                                                               <----
                                                                                               -----
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                             -------
                                                                                             -------
                                                                                             <------
                                                                                             -------
                                                                                             -------
                                                                                             -------
                                                        <---------ANAC46                     <------
                                                        --------->ANAC55(2)                  -------
                                                        <---------ANAC58                     <------
                                                        <---------ANAC55(2)                 <-------
                                             --------->YAB1                                 --------
                                            <---------AHL12(1)                              <-------
                                           --------->AHL20(3)                               --------
                                           --------->AHL25(2)                               --------
                                           <---------AHL20(3)                               --------
                                           --------->AHL20(2)              <---------ARR11(3)<------
               <---------YAB1 --------->AHL12(2)   <---------GLK1(2)       --------->ARR11(3)-------
              <-----------GT1 <---------WOX13(2)   <---------ICU4          --------->ARR14(2)<------
           <---------AHL12(2) --------->WOX13(2)--------->YAB1     <---------AHL12(1)       --------
      --------->YAB5   <---------ANAC46    <---------AHL25(2)      --------->AHL12(1)       <-------
   --------->YAB5  <---------DOF5.7(1)----------->GT1   <---------ANAC58   <---------ARR14(2)<------
 
actaaacgatgactaattttcattttttgtgtaaattactagggaaaataataagaatttcgtattttgaatttttagtatcttgacaaaaacaaaataa  8678400
         --------->AHL25(1)
         --------->AHL20(3)
         <---------AHL20(3)
         <---------AHL25(2)
         --------->AHL25(2)
         --------->AHL12(1)
         <---------AHL12(1)
         <---------ICU4
         <---------AHL25(3)
     <---------AHL20(2)
     <---------AHL12(3)
     <---------AHL12(1)
     --------->AHL12(1)
     --------->AHL20(2)
     <---------AHL25(2)
     --------->AHL25(3)
     --------->AHL12(3)
     <---------AHL25(3)
     --------->AHL25(2)
     --------->AHL25(1)
     <---------AHL25(1)
    --------->AHL25(2)
    <---------AHL25(1)
    --------->AHL25(3)
    <---------AHL25(2)
    --------->AHL25(1)
    <---------AHL20(3)
    <---------AHL20(2)
    --------->AHL20(2)
    <---------AHL20(1)
    --------->AHL12(3)
    --------->AHL20(3)
   --------->AHL12(2)
  <---------WOX13(2)
  --------->WOX13(2)
--------->GT1
----->ICU4
-----AHL12(2)
---->AHL12(2)
----AHL25(3)
--->YAB5 <---------AHL20(2)
----ICU4 <---------AHL25(1)
-->AHL25(2)
-->AHL20(2)
---AHL12(3)
-->AHL12(3)
-->ICU4--------->AHL12(2)
-->AHL25(1)
---AHL25(1)
-->AHL12(1)                                                     --------->TOE2(3)
---AHL12(1)                                                     --------->AtMYB61
--AHL20(3)                                                      --------->TOE1(3)
->AHL20(3)                                                      <---------MYB59
--AHL25(2)                                              -------->ATHB1
->AHL25(3)                                              <---------AHL12(1)                         <
->AHL12(2)                                              --------->KAN1                             -
->AHL25(2)                                              --------->AHL25(1)                         <
---AHL25(3)                                             --------->AHL12(1)                         -
-->AHL25(3)               --------->TOE2(3)            <---------AHL12(1)             --------->REM1(1)
---AHL20(2)             <---------ARR11(3)             <---------YAB5             <---------At4g35610
->AHL20(2)     <----------DOF2                         <---------KAN1             --------->At4g35610
--AHL20(1)  <-----------GT1                            --------->AHL25(3)--------->AtMYB61         <
---ATHB51--------->AHL20(2)           --------->YAB5   --------->ICU4--------->MYB46(3)       <-----
 
ttagtaatttaattttttctttatcaatttcttaaactgaaccatgaactaattcagaattattcaacctaaaccaccaaaatttagctacaactagttt  8678500
                                                                                          <---------ARR14(2)
                                                                                          --------->GATA12
                                                                                   <---------AHL12(2)
                                                                                   <---------YAB1
                                                                                  --------->AHL20(3)
                                                                                  <---------AHL20(2)
                                                                                  --------->AHL12(3)
                                                                                  <---------AHL20(1)
                                                                                  <---------AHL20(3)
                                                                                  --------->AHL25(2)
                                                                                  <---------AHL25(2)
                                          <---------------AtSPL8                  --------->AHL12(2)
                                          --------------->AtSPL8                 --------->AHL12(1)
                                         <---------WOX13(1)                     --------->AHL12(2)
    --------->YAB1                 --------->ANAC58                             <---------YAB5
  <---------WOX13(2)            --------->DOF5.7(1)                             <---------YAB1
  <---------TOE2(3)           ---------->DOF2                              <---------bZIP60(1)
  --------->WOX13(2)         <---------AHL20(2)                            --------->bZIP60(1)
---------AHL20(3)          --------->WOX13(2)                             <---------TOE2(3)
-------->AHL20(2)          <---------WOX13(2) <-------TEIL              ----------->HVH21 <---------GLK1(2)
---------AHL25(1)    --------->YAB5--------->ANAC58                     ----------->TGA1  --------->ARR14(2)
-------->AHL20(3)   --------->MYB46(3)  <---------WOX13(2)        --------->WOX13(1)      --------->ARR11(2)
---------AHL20(2) --------->ARR11(2)    --------->WOX13(2)<---------ARR14(2)    --------->ICU4
----AHL20(2)  --------->MYB59--------->AHL20(2)       --------->YAB5 --------->RVE1(2)    <---------RVE1(2)
 
attttaatgaaaacattttggtaaccactaaattaaagacgctaattggtacatatatgagtattctatcaatctctgacgttattatttttggattctc  8678600
                                            ---------->DOF2
                                <---------GLK1(1)
                                --------->GLK1(1)                                --------->YAB1
                               --------->ARR11(3)                         --------->YAB1        ----
                               <---------ARR11(3)                       --------->RVE1(2)       ----
                             --------->ANAC58                       --------->ANAC46         -------
                             --------->ANAC58                --------->YAB5      ----------->GT1----
      <---------AtLEC2<---------KAN1   --------->At4g35610  --------->MYB46(3)--------->GLK1(1) ----
 
acatattttgtatgaagaaaacagaattacacaagatatcacagctataaagaacacatttcaacaactacacaaaatcagaaatcgtaacaacttcaca  8678700
<- Previous    Next ->

AGI:  At3g24010.1   
Description:  PHD finger family protein. similar to PHD finger protein-related [Arabidopsis thaliana] (TAIR:AT1G54390.3); similar to PHD finger protein-related [Arabidopsis thaliana] (TAIR:AT1G54390.4); similar to PHD finger protein-related [Arabidopsis thaliana] (TAIR:AT1G54390.5); similar to predicted protein [Physcomitrella patens subsp. patens] (GB:EDQ54844.1); contains InterPro domain Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); contains InterPro domain Zinc finger, PHD-type; (InterPro:IPR001965); contains InterPro domain Zinc finger, FYVE/PHD-type; (InterPro:IPR011011)
Range:  from: 8675963    to: 8678227    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version