AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                         ==================HOX2a_HOX2a           <---------At4g35610
                                         ------>ZmHOX2a(2)                       <---------GLK1(1)
                                        <------ZmHOX2a(2)                        --------->GLK1(1)
                                        ===================HOX2a_HOX2a           --------->ZAT2
                                        --------->At4g35610                      --------->At4g35610
                                        <---------At4g35610                      <---------ZAT2
                                       <---------ARR11(3)                       ----------->ARR10
                                       --------->ARR11(2)                  <---------MYB46(3)
                                       --------->ARR14(2)                 --------->ALFIN1
                                       <---------ARR14(2)                 <---------AtMYB61
                                       <---------AGP1                    <-------GAMYB
                                       <---------ARR11(2)                --------->ATERF1(1)       -
                                       --------->GATA12                 <---------DEAR3(2)         -
                                     <------NtERF2                      <---------MYB46(3)         <
                                    ------>NtERF2                      <---------DREB2C(2)       ---
                                    --------->LBD16                    <---------DEAR3(1)       ----
                                   --------->LBD16                  <---------DEAR3(1)          ----
                                   <---------LBD16                --------->ARR11(2)           <----
                                  <---------LBD16                <---------ARR14(2)          -------
                                  <------NtERF2                  --------->ARR11(2)         --------
     ---------->DOF2              --------->ATERF1(1)            <---------ARR11(2)       ----------
----------->RAV1(1)        ---------->DOF2                  <---------ANAC46   <------ZmHOX2a(1)----
---GAMYB                ----------->GT1<---------GATA12 --------->CCA1(2)<------NtERF2--------->LBD16
----MYB46(3)    --------->YAB5   <---------RAP2.3(1)<------ZmHOX2a(1) <---------ABI4(1) ----------->HVH21
--->AtMYB77    <---------KAN1   <---------DEAR3(1) ----------->GT1--------->ARR14(2)<---------LBD16<
 
ttgcgacatagagcgagaatgtctaggttgtaaagtcgccgggatctgagagtaaggagaaatgggtggaatcggcggtggaggagctccggtgaaaggg  9103000
        <---------AtMYB61
     --------->ALFIN1
-------->ANAC58
-------->ANAC58
---------ANAC46                  <xxxxxxxxxxxxxxxxsmallRNA(i)
------>MYB52(1)                --------->ARR14(2)
------->HVH21                 ===================================HOX2a_HOX2a              --------->ZAT6
----->ALFIN1                  <------ZmHOX2a(1)                                         <-----------GT1
-------HVH21         <---------KAN1                                              >>>>>>>>>TBF1
-->DOF5.7(1)        <---------ARR11(2)                                     <---------------AGL15
->DOF5.7(1)         --------->ARR11(2)                    ------>ZmHOX2a(2)--------------->AGL15
>DOF2----------->HVH21 --------->DOF5.7(1)     <---------ANAC46            --------->HSFB2a(2)
------->TGA1    <---------At4g35610      --------->ICU4 <---------GATA12   <---------HSFB2a(2)
---------ANAC55(2)  <---------ARR14(2)   <---------YAB1 --------->GATA12 ------->TEIL<---------AHL12(2)
 
tgacggaagtgatggtgagagcggataagagcaggattcaagtgaagattgtgtttagggatcgaagaagacgatgtaccagaagaagaattaactctct  9103100
                                      <---------YAB1
                               ------>MYB46(1)
                          --------->DEAR3(1)
                          <---------ALFIN1
                          --------->AtMYB61
                         --------->MYB46(3)
                       --------->ANAC46
                       <---------ALFIN1
                       --------->AtMYB61                          ---------->DOF2
            <-----------RAV1(1)------>MYB83            --------->LBD16
         <---------ARR14(2)  --------->AtMYB61     <---------ARR14(2)
         --------->ARR11(2)  --------->DEAR3(1)    --------->GLK1(2)
         <---------ARR11(2)  <---------ALFIN1      <---------ARR11(2)     <---------GLK1(2)      ---
         --------->ARR14(2) --------->MYB46(3)   --------->KAN1  <---------AHL25(3)  >>>>>>>>>TBF1
--------->YAB1        --------->MYB46(3)<---------RVE1(2)     --------->YAB1  <----------DOF2    ---
 
gcatcatattggtatctgttgtatcaccaccaccacccattttgattttctgagattccgaacaaaaataaaagtcagaaactttgaagaagaaccaaaa  9103200
                                      --------->YAB1
                                      --------->ATHB51
                                      <---------ICU4
                                      --------->ATHB12
                                      -------->ATHB1
                                      <--------ATHB1
                            --------->GLK1(1)     --------->LBD16
                 <---------MYB52(1)  --------->ICU4--------------->AGL15
                ------>ZmHOX2a(1)    <---------ATHB12
            <---------RVE1(2)        <---------ATHB51
     <---------TOE2(3)     --------->GATA12      --------------->AGL15
    ---------->DOF2        <---------GATA12 <---------GLK1(1)
 <---------WOX13(2) <---------At4g35610   --------->ATHB12
 --------->WOX13(2) --------->At4g35610 <---------WOX13(1)   ----------->GT1    ---------->DOF2
------>TOE2(3)  <----------DOF2      <---------YAB1<---------------AGL15    ---------->DOF2
------>TOE1(3)------>ZmHOX2a(2)    --------->YAB1<---------------AGL15   --------->YAB1       ------
 
ccctaactaaagtttgatcctttagctggagatttcaacaataattgatttcccccaaatagagaagataaatctattagaaagaaagaaatttgacctg  9103300
                                               <---------ANAC46
                                               ----------->GT1                          --------->GLK1(2)
                                        <---------ATHB12                               <---------GLK1(2)
          --------->GATA12             --------->ANAC58                               --------->YAB5
          ------->TEIL                 --------->ANAC58                            --------->MYB52(1)
     ----------->GT1                  --------->WOX13(1)    --------->DOF5.7(1)   --------->DOF5.7(1)
----->HVH21<---------KAN1           <---------At4g35610   ---------->DOF2  ---------->DOF2
 
aaatggggaagtgaatctctctctctctgtgttttcttcagcaatcaatggcgaaaatagcgaaagaaggaaggaactaaaagaaaaaacgattcttttg  9103400
                 <---------ATHB12
                 <---------YAB5
               --------->WOX13(1)
             --------->At4g35610                     --------->AHL20(2)
       ---------->DOF2                       <---------ANAC58
      --------->AtMYB61             --------->YAB5 <---------WOX13(2)
   <---------WRKY18(1)       --------->ETT(1)<---------ANAC58      --------->YAB5
  --------->WRKY45         *TSS    --------->DOF5.7(1) <---------ANAC55(2)
  --------->WRKY12--------->YAB1 ---------->DOF2   --------->WOX13(2)    <-----------GT1
  --------->WRKY38(1)--------->MYB46(3)      <---------ANAC46     <---------YAB1 --------->YAB1
 --------->DOF5.7(2)<<<<<<<<<<<<<<<<<LFY  <----------DOF2       <---------KAN1 --------->RVE1(2)
 
aaacgttgaccaaagcagcaatcatccactggtcggaaaagactactttcgtctaattacatatagagtatgtttatttctctatcaaattcaacaaatt  9103500
                ------------>CBF
               --------->TOE2(3)
           <---------AHL12(1)
           --------->AHL20(2)
           <---------AHL20(2)
           <---------AHL25(1)
           <---------AHL25(3)                                                   --------->AHL12(1)
           --------->AHL12(1)                                                   <---------AHL12(1)
           --------->AHL25(1)                                                  --------->AHL12(3)
          --------->AHL25(3)                                                   <---------AHL12(2)
          <---------AHL12(2)                                                   <---------AHL25(1)
          --------->AHL25(2)                                                   --------->AHL20(2)
          --------->AHL20(2)                                                   --------->AHL25(2)
          <---------AHL25(1)                                              --------->AHL20(2)
          --------->AHL12(3)                                          <---------AHL12(1)
         <---------AHL12(2)                                          <---------AHL20(3)
         --------->AHL12(2)                                          <---------AHL12(1)
       --------->ICU4                                                <---------AHL25(2)
      --------->AHL12(2)                                             --------->AHL20(3)
      <---------AHL25(2)                                             --------->AHL12(1)
      --------->AHL25(2)                                             --------->AHL25(3)
      <---------AHL12(2)                         --------->WOX13(2)  --------->AHL25(2)
      <---------AHL12(3)                ---------->DOF2              --------->AHL20(1)
      --------->AHL12(3)         ---------->DOF2 <---------TOE2(3)  --------->AHL12(3)
     <---------AHL25(3)     --------->DOF5.7(1)  <---------WOX13(2) --------->AHL12(2)
     --------->YAB1  --------->YAB1 <----------ID1 --------->AHL20(2)<---------AHL20(1)         ----
    --------->AHL20(2)     --------->AHL20(2)<----------DOF2        --------->YAB1  --------->YAB1
--------->AHL20(2)   ------------------------>ANAC81    --------->AHL20(2)<---------AHL20(2)--------
 
tgataaaataaaaattaatctcaataacaaaaaaatgaaagaacaaagctttaatgaaataaactaaacaaaaatattaaaaaaaaatcatattgtctga  9103600
                       --------->YAB1                                                             <-
                      <---------YAB5                                                             <--
                  <---------AHL12(2)                                                             <--
                 --------->YAB1                                                                  <--
                <---------AHL25(3)                                                              <---
                --------->AHL20(2)                                                              <---
                <---------AHL20(2)                                                 --------->AHL20(3)
               --------->AHL20(3)                                         --------->MYB59       <---
        --------->ARR11(2)                                            <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
       --------->At5g28300      >>>>>>>>>GATA-1                     <---------MYB52(1)         -----
       <-------GAMYB--------->YAB1                                 ------>ZmHOX2a(1)   <-------TEIL
  ----------->HVH21<---------YAB1   <---------GATA12               <----------DOF2 <---------AHL20(2)
--->TEIL<---------ARR11(2)    ----------->GT1                   <---------YAB5    --------->AHL20(2)
------->AtSPL8 --------->AHL20(2)   --------->RVE1(2)    --------->ICU4--------->WOX13(2)      <----
 
accctctcacggttacaaatttataatcatatatagataaatctaaaacaacttgaagacatgtttaatcctttagttatgtccataaaattcatggttt  9103700
                                                                                             <------
                                                                                             -------
                                                                                           <--------
                                                                     xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                                     xxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                                    <---------WOX13(1)     <--------
       <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                        <xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
      --------->ATHB12                                             <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
      --------->YAB5                                               xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                       xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
      <---------ICU4                                              --------->ATHB12         <--------
     <---------YAB1                                              <---------YAB1            <--------
     --------->ICU4                                              --------->ICU4            <--------
     <---------YAB5                                            <---------At4g35610         <--------
-------P                                                    xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)<-----
-----GAMYB                                                 <-----------RAV1(1)           --------->ALFIN1
-------ANAC58                                              xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
-------ANAC58                                             <---------ANAC58        xxxxxxxxxxxxxxxxxx
---MYB83                                                  <---------ANAC58        xxxxxxxxxxxxxxxxxx
------MYB46(3)                            <---------YAB1  <---------ANAC46       --------->ALFIN1  <
---MYB46(1)       --------->WRKY12<----------DOF2       xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)<---------LBD16
---->MYB59 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)  <xxxxxxxxxxxxxxxxxxxsmallRNA(si3)     xxxxxxxxxxxx
-----AtMYB61      ----------->HVH21     <---------KAN1 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)<-------
 
ggttgctcatgattaaactcgttgacattgcattgctctttgaatatgtttgggtccaattgctggtgctgattgaactcataggtgttgagttgcggct  9103800
      xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
      xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
   <-------MYC3
   ------->MYC3
<---------ALFIN1
---At4g35610
-->At4g35610
-RRTF1(2)      xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
-ANAC46        <---------WOX13(1)
-RAP2.3(2)    xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
-RAP2.6(2)  xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
-ANAC58     xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
-ANAC58<---------AtMYB61                        <---------RVE1(2)            --------->AHL20(2)
----ANAC46xxxxxxxxxxxxxxxxxxxx>smallRNA(si3) <------MYB46(1) ----------->HVH21           <---------GLK1(1)
xxxxx>smallRNA(si3)           ------->TEIL   <------MYB83  --------->At4g35610       <---------MYB52(1)
xxxx>smallRNA(si3)   <---------AtLEC2 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)--------->TOE2(3)
xxxxxxxxxxxxxxxxxxsmallRNA(si3) --------->TOE1(2)   <-----------GT1        <----------DOF2xxxxxxxxxx
xxxxxxxx>smallRNA(si3)  --------->ATHB12   <--------P      ----------->RAV1(2)  --------->GATA12
--RAP2.3(1) xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)<---------KAN1      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
 
ggaacacgttttggtccgattgatgcatggttgaaccctcgaactggttgggatttttcatcccctgaccagttgctactttaaatcggttgatttcagc  9103900
<- Previous    Next ->

AGI:  At2g21230.1   
Description:  bZIP family transcription factor. similar to bZIP protein [Arabidopsis thaliana] (TAIR:AT4G38900.2); similar to bZIP protein [Arabidopsis thaliana] (TAIR:AT4G38900.3); similar to bZIP transcription factor bZIP28 [Glycine max] (GB:ABI34675.1); contains InterPro domain bZIP transcription factor, bZIP-1; (InterPro:IPR011616); contains InterPro domain Basic-leucine zipper (bZIP) transcription factor; (InterPro:IPR004827)
Range:  from: 9100705    to: 9103428    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g21235.1   
Description:  bZIP protein-related. similar to DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT2G12900.1); similar to predicted protein [Physcomitrella patens subsp. patens] (GB:EDQ49445.1); contains InterPro domain Basic-leucine zipper (bZIP) transcription factor; (InterPro:IPR004827); contains InterPro domain Basic leucine zipper; (InterPro:IPR011700)
Range:  from: 9103673    to: 9105848    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version