AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                          <---------At4g35610  <----
                               <---------ANAC46                           --------->At4g35610<------
                               <---------ANAC58                    <---------ARR14(2)       <-------
             ------->GAMYB--------->KAN4(2)                        --------->ARR11(2)       --------
            <---------ALFIN1   <---------ANAC58                    --------->ARR14(2)       <-------
    <---------ARR14(2)   --------->YAB5                            --------->GATA12--------->ZAT14
    --------->GATA12     --------->KAN1                            <---------ARR11(2)       --------
    --------->RVE1(2)   =========================HOX2a_HOX2a <---------GATA12      <---------ZAT14
    --------->ARR14(2)  <------ZmHOX2a(2)                    --------->GATA12      --------->ZAT18
----->ZmHOX2a(1)        <---------YAB1    <------ZmHOX2a(1) <---------GLK1(1)     >>>>>>>>>>>>>>>>>LFY
tcctccaaatccctaacaccctctacgatcattcgcgtgtatttaggacaatttgaagaaatgaaatctgaatcggcctctgagagtccagtgtctcgtc  29685300
                                                                --------->HSFB2a(1)               --
                                                                <---------HSFB2a(1)            <----
                                                                <---------KAN1                 -----
                                                                <---------GLK1(1)              <----
                                                                --------->GLK1(1)              <----
                                                               --------->ARR11(2)              <----
                                                               ------->TEIL----------->HVH21  <-----
      --------->ANAC58                                         --------->GATA12             --------
 --------->GLK1(1)                                             --------->ARR14(2)     <---------ARR11(2)
----NtERF2                                                     <---------ARR11(1)     <---------ARR14(2)
-----DEAR3(1)                                                  <---------ARR14(2)     --------->ARR14(2)
-----HVH21                                                     <-----------ARR10      --------->ARR11(2)
--TGA1a             <---------ZAT18                            <---------GATA12      <------NtERF2<-
->TGA1a        <---------GLK1(1)                              <---------CCA1(2)     --------->LBD16<
--O2  --------->ANAC46       --------->ATHB12           --------->KAN1   <----------DOF2    --------
->O2  --------->ANAC58      ------>ZmHOX2a(1) <---------KAN1  <---------GLK1(2)    <---------ANAC46-
ggagaaacccagcaattgaattctgcgcttcctgatttgtctgcgaagaattagagctaaaattcgaatctccgtgctgtaacgaggcggaaacagtgac  29685400
      <---------TOE2(3)     --------->ANAC46
=====bZIP_DOF               <---------ANAC55(2)
------->RAP2.6(2)           --------->ANAC58
-----ANAC46              <---------ARR11(2)
---->O2                  --------->ARR11(2)
-----TGA1a               <---------ARR14(2)
-----bZIP60(2) ----------->GT1----------->HVH21
-----O2--------->YAB1    --------->ARR14(2)
------------------TaNAC69(2)--------->ANAC58                   <---------TOE2(3)
--->TGA1    --------->ZAT2  <---------ANAC58                  ---------->DOF2        <------ZmHOX2a(1)
--------ATERF1(1)     <---------TOE2(3)              <---------At4g35610      ---------->DOF2 <-----
------NtERF2--------->At4g35610  <---------ANAC46    --------->At4g35610 <---------ARR11(3)   <-----
--->HVH21   <---------At4g35610  <---------O2        --------->ZAT2     <------ZmHOX2a(1)--------->GLK1(1)
----->NtERF2<---------ZAT2--------->KAN1             <---------ZAT2<-----------GT1  ----------->GT1
gcggccactatggtaagctggaaacaaggttacgcgacgaggagagaagaagagagagctggaactaaagttacaggattttaaaggaggagaaatcaag  29685500
<---------TOE2(3)          ---------->DOF2                                    <---------ANAC58
<---------TOE1(3)     <---------TOE2(2)                         --------->DOF5.7(1)   <---------ALFIN1
----TOE2(3)           ------->TEIL                            ---------->DOF2 <---------ANAC58
----TOE1(3)      <------ZmHOX2a(1)                        <----------ID1  <----------DOF2        <--
gttagggtttcgaaattgcaggacgtatgtaaaagctccataaacaaacacgatggagaagaagacaaaggtcgctactttgcttctgcccacatcaaga  29685600
                                                                    --------->AHL25(2)           ---
                                                                    <---------AHL12(1)          <---
                                                                    --------->AHL25(1)         <----
                                                                    <---------AHL25(1)         <----
                                                                    --------->AHL12(3)         <----
                                                                    <---------AHL25(2)        ------
                                                                    --------->AHL20(2)        <-----
                                                                    <---------AHL12(3)        <-----
                                                                   --------->AHL20(2)         <-----
                                                                   --------->AHL25(1)       <-------
                                                                   --------->AHL12(3)       <-------
                                                                   --------->AHL25(3)      <--------
                                                                   --------->AHL25(2)      <--------
           <---------MYB46(3)                                      <---------AHL25(2)      <-------GAMYB
           <-----------RAV1(1)                      <---------RVE1(2)<---------AHL25(3)  --------->LBD16
        --------->GLK1(2)                         <---------YAB1  --------->WOX13(2)    <---------LBD16
    >>>>>>>>>TBF1                           <---------YAB5        <---------WOX13(2) --------->ARR14(2)
 >>>>>>>>>TBF1     ----------->GT1        <-----------GT1        ------>MYB83        <---------ARR14(2)
----ZmHOX2a(1)  <---------AtLEC2<---------RVE1(2)*TSS            ------>MYB46(1)     --------->RVE1(2)
ggaagaagaagaagctgttgcagggtttatctgtagctatgggtttaaccattttgattttcaaaaccaaattaattaataaaaccaaaatcccggttgg  29685700
--MYB46(1)                                                            --------->ATHB12
--MYB83                                                   <---------ICU4<---------WOX13(1)
--->MYB59                 <---------AHL20(3)              <---------AHL20(2)
-MYB83                    <---------AHL20(2)              <---------AHL25(3)
----MYB46(3)              <---------AHL25(1)             --------->AHL20(2)
-MYB46(1)                 <---------AHL12(3)            --------->WOX13(2)                      >>>>
-P   <-----------HVH21    --------->AHL20(2)            <---------WOX13(2)      ------------>MYB.PH3(1)
--MYB52(1)              <-----------TBP                --------->YAB1--------->ICU4            -----
---HVH21      <------------CBF                      <----------DOF2  <---------YAB1          <------
-MYB52(1)    --------->ATHB12                   <---------GLK1(2)    <---------YAB5  <---------MYB52(1)
gtcaaaccggtctgagccattgggcctatttatatgggctcttacattatcgattctttaataaatacagtattgattgttcaaaaccgttatgggccta  29685800
  --------->DOF5.7(1)  <---------AHL12(2)
  --------->DAG2       --------->WOX13(2)
 --------->DOF5.7(1) --------->AHL20(2)
 ---------->DOF2     <---------AHL12(1)
 --------->DAG2      --------->AHL12(1)
--------->DOF5.7(1) <---------YAB1    ------>MYB46(1)              ---------->DOF2
---------->DOF2   --------->YAB5      ------>MYB83               --------->At4g35610
>>>>>MYB98 <---------ANAC55(2)      <---------MYB59            --------->YAB1
---->MYB52(1) --------->MYB52(1)  --------->RVE1(2)           <---------ATHB12                <-----
---MYB59--------->ARR11(2)<-----------GT1   ------>ZmHOX2a(1) <---------YAB5        <----------DOF2
acaaaaaggcggttacataactgattatttaacagaataccaaattcctctaatgctatacactaatcagcaaagaaacttgctctgcttttgtttataa  29685900
                                                        --------->GLK1(2) <---------HSFB2a(2)
                                                       <---------GLK1(2)  --------->ANAC55(2)
           <---------ZAT6                              <---------RVE1(2) <---------LBD16
         <---------ANAC58                            <---------TOE2(3) --------->GLK1(2)
         <---------ANAC58                       <------ZmHOX2a(1)     <---------ARR14(2)      <-----
     <---------WOX13(2)              --------->RVE1(2)--------->KAN1 --------->KAN1       <---------ANAC58
     --------->WOX13(2)    <---------ANAC58    <---------YAB1  --------->ZAT2--------->ARR14(2)
------>ZmHOX2a(1) <---------ZAT18   <---------CCA1(2)<---------RVE1(2)<---------GATA12    <---------ANAC58
------GT1<---------ANAC46  <---------ANAC58 --------->TOE1(2)  ----------->RAV1(2)   <---------O2
ctcctgcaaattgagtgttagagcacatttgcttccctcatatcaaaactaggattgagattctgcagctggagattccggaatcgagacttggctagtg  29686000
                   ------>ZmHOX2a(1)                                               --------->RVE1(2)
                 <---------ANAC58                                            --------->ANAC58
                 <---------ANAC58                             --------->MYB52(1)   --------->ARR11(3)
              <---------GLK1(1)                            <---------DOF5.7(1)     <---------ARR11(3)
              --------->GLK1(1)                       <---------CCA1(2)      --------->ANAC46    <--
         <---------ANAC58                            --------->RVE1(2)       --------->ANAC58-------
         --------->TOE2(3)                           ------>MYB46(1)       <-----------RAV1(2)------
     <----------DOF2                                <---------CCA1(2)   --------->At4g35610 --------
----ZAT6 <---------ANAC58             --------->ZAT14------>MYB83       <---------At4g35610 <-------
tttggagactttccttgatttcctgcataaaacacactctctaaactctcttcacctatctctcttaaccgattgagctcaggcaatatctctttcccga  29686100
                          --------->ANAC46                                                 <------ZmHOX2a(2)
                         <---------LBD16                                                   =========
                         --------->LBD16                                                  <---------GATA12
                        <---------ANAC58                                             <---------At4g35610
                        <---------ANAC58                                         --------->ARR11(2)-
     <---------CCA1(2) <---------LBD16---------->DOF2                            --------->ARR14(2)-
--------->MYB59      --------->ARR14(2)                                          <---------ARR11(2)-
---------HVH21       <---------ARR11(2)                                          <---------ARR14(2)<
-->LBD16<---------DOF5.7(1)     ---------->DOF2                                 <---------MYB52(1)--
--->LBD16<----------DOF2<---------ANAC46                                       --------->LBD16------
->HSFB2a(2)          <---------ARR14(2)          ---------->DOF2      --------->ANAC46    --------->GATA12
--HSFB2a(2)          --------->ARR11(2)    <----------DOF2    <-----------------AGL1 --------->At4g35610
ggtcaggtctatcttttcttcttagttccgcgcattgaagcgaaagctttgctaaagatagagcttcttctataggccagtccggtactgctggatcaag  29686200
<- Previous    Next ->

AGI:  At1g78930.1   
Description:  mitochondrial transcription termination factor-related / mTERF-related. similar to EMB2219 (EMBRYO DEFECTIVE 2219) [Arabidopsis thaliana] (TAIR:AT2G21710.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO41706.1); contains InterPro domain Mitochodrial transcription termination factor-related (InterPro:IPR003690)
Range:  from: 29682990    to: 29685650    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At1g78940.1   
Description:  protein kinase family protein. similar to kinase [Arabidopsis thaliana] (TAIR:AT2G24370.1); similar to protein kinase family protein [Arabidopsis thaliana] (TAIR:AT1G16760.1); similar to protein kinase family protein [Arabidopsis thaliana] (TAIR:AT3G20200.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN69465.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO41708.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO43975.1); contains InterPro domain Serine/threonine protein kinase; (InterPro:IPR002290); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kina
Range:  from: 29685750    to: 29688855    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version