AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                               <-------TEIL
                                                              --------->CCA1(2)
                                                             <---------GLK1(2)
                                                             <---------RVE1(2)
                                                             <---------GATA12
                     <---------ETT(1)                        --------->ARR14(2)
                     ----------->HVH21           --------->LBD16--------->MYB59
                  --------->ARR11(2)            <---------HSFB2a(2)
                  --------->RVE1(2)             --------->HSFB2a(2)  <------NtERF2
                  <---------ARR14(2)        --------->DEAR3(1)--------->GLK1(2)
                  <---------ARR11(2)      ------->GAMYB      --------->ARR11(1)
        --------->DOF5.7(1)              --------->ANAC58    <---------ARR14(2)
      ---------->DOF2--------->ANAC46    --------->ANAC58   --------->KAN1 <-----------GT1<---------AtMYB61
--------CCA1(2)   --------->ARR14(2)     --------->ANAC46  <---------RVE1(2)     <--------P
-----YAB5        --------->KAN1     ------>ZmHOX2a(1) <---------WOX13(2) <----------DOF2<----------DOF2
-AHL20(2) --------->MYB52(1) <---------ALFIN1 --------->AtLEC2--------->ARR14(1)<-----------HVH21  <
 
catctcttcaaaagaccggcctatccgacccctcacttcctccaacgccatccagaaaattagagattcggtcgcgatttacaggttagggctttggttt  26758400
                                  --------->LBD16
                                  <---------TOE1(2)
                                  <---------TOE2(2)                                               --
                        <------NtERF2                                                             --
                       ------>NtERF2                                                              <-
              <---------ANAC55(2)<---------ALFIN1                                                ---
             <-------TEIL    --------->ZAT18                                                --------
      <---------ANAC55(2)   <---------ATERF1(1)                                             --------
     <-------TEIL      --------->LBD16                                                --------->YAB1
    <---------KAN1    <---------LBD16                           --------->YAB1       ---------------
   <---------ARR14(2) --------->ETT(1)                        --------->RVE1(2)      <--------------
   --------->ARR11(2) --------->LBD16                        <---------ICU4         ----------------
   --------->ARR14(2)<---------ANAC46          <---------AHL20(2)              --------->ZAT14   <--
   <---------ARR11(2)<---------LBD16 --------->ALFIN1       --------->ICU4<---------At5g28300  -----
---------LBD16--------->ANAC55(2)<-----------RAV1(2)   ----------->GT1   <-----------GT1 --------->YAB1
 
tgctcggatacataaatacgtcttgccgggactgccccaggtttggctgtttaataagttgtaaaaatcacaagttttacagtttacacccataatagta  26758500
         --------->WOX13(2)
        <---------AHL12(2)
       <---------AHL12(1)
       <---------AHL20(2)
       <---------AHL25(2)
       --------->AHL20(2)
       <---------AHL25(1)
       --------->AHL25(2)
       --------->AHL12(1)
       --------->AHL20(3)
       <---------AHL20(1)
       --------->AHL25(1)
  ------------>CBF
 --------->YAB1
------->YAB1
------->YAB5           --------->ANAC58                                             <----------DOF2
--------ICU4           --------->ANAC58                                            --------->TOE2(3)
------>ICU4          ---------->DOF2                                          --------->KAN1
--->GT1<---------AHL25(3)                                                ----------->GT1
->YAB1 --------->AHL25(3)                                               <---------TOE2(3)        ---
>AGL15 --------->AHL20(1)                      <-----------GT1          --------->DOF5.7(1)      ---
-AGL15 <---------AHL20(3)         ------>ZmHOX2a(1)                    --------->DOF5.7(1)       ---
->AGL2--------->AHL25(3)          --------->LBD16 <----------DOF2     --------->DOF5.7(1)   <-------
-------YAB1       --------->At4g35610          ---------->ID1         ---------->DOF2<---------MYB52(1)
---->YAB1<---------WOX13(2) --------->KAN1    <-----------GT1        --------->DOF5.7(1)--------->AHL12(2)
 
ataataacaataaattaggggagcgaaagcaaaattcctgaaatttgtttttcctttctgcccaaacaaaaaaaaaaggttttattcctttattttttcc  26758600
                              <----------ID1                       --------->At4g35610
                              --------->ANAC58                 --------->MYB52(1)
                           ------->GAMYB                    <---------ANAC55(2)
                          --------->MYB46(3)                --------->ANAC55(2)                  ===
  <-----------HVH21  <---------ANAC55(2)                --------->RVE1(2)                        ---
----->P              --------->ANAC55(2)               <---------KAN1           <---------CCA1(2)===
--->MYB46(1)     --------->RVE1(2)               ---------->DOF2   <---------At4g35610           <--
--->MYB83       <---------KAN1--------->ANAC58   --------->DOF5.7(1) <---------MYB46(3)--------->YAB1
----GT1  <----------DOF2--------->MYB52(1)------------------------>ANAC81  ------>ZmHOX2a(1) -------
 
aaccttgtcagactttagaacatcacataacagacgacaaaaaaaaaaaaaaaaaagaacatcacataacagctgttcctctcatctctcttataaggtc  26758700
                   <---------ANAC58
          <------ZmHOX2a(2)
          --------->KAN1
         --------->ARR14(2)
         <---------GATA12
         <---------RVE1(2)
         <---------ARR14(2)
         --------->GATA12
         --------->AGP1
         <---------ARR11(3)                                                                  ------>ZmHOX2a(2)
         --------->ARR14(3)                                                                ---------
         <---------ARR14(3)                         --------->YAB1                         <--------
         --------->ARR11(3)                         --------->ZAT6                         ---------
        --------->GLK1(1)                           <---------ICU4                         <--------
       ----------->ARR10                            --------->YAB5                      <--------P
   <---------At4g35610 <----------DOF2             <---------ATHB12                   --------->ATHB12
<---------At4g35610<---------ANAC58              --------->WOX13(1)                  <---------YAB1
=================HOX2a_HOX2a                   ------------>CBF                    <---------ICU4
--->ZmHOX2a(1)     <---------ANAC46           --------->RVE1(2)                    --------->YAB1
==================HOX2a_HOX2a          <---------WOX13(2)                         <---------ATHB12
-------At4g35610<---------MYB52(1)     --------->WOX13(2)             <---------YAB5 <---------YAB5-
-->ARR11(3)------>ZmHOX2a(2)          ----------->GT1       ---------->DOF2       --------->ICU4   -
 
ctctgcttctgagatcttcgttgcttctttgccttctggtttagtttaaaatcaatcactaccaaaagccctaatcacagaagaaatcatggttgatctc  26758800
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                   <
                                                                                            --------
                                     --------->MYB59                                     --------->YAB1
                                  --------->ARR14(2)                                    <---------YAB1
                                  <---------ARR14(2)                              <---------YAB1   -
>ARR11(3)                      --------->LBD16                                   --------->KAN4(2) -
-GATA12                <----------DOF2                                          --------->KAN1------
>GATA12               <---------DOF5.7(1)                           <---------ARR11(3) --------->AHL20(3)
-ARR11(3)   <---------AHL12(1)--------->LBD16                       --------->RVE1(2)  <---------AHL20(3)
--------->DOF2      <---------ARR11(3)        --------->ANAC58      --------->ARR11(3)--------->YAB1
-------->ZAT14      --------->ARR11(3)        --------->ANAC58     <---------CCA1(2) <---------YAB1<
 
agtaaagacttacaatttttcaaggtctttctccctgaattcggttctcacgaactggtatacttgttttatatctcatcagtttattcttataatatca  26758900
                                 --------->ARR14(2)
                                 --------->GATA12
                                 <---------GATA12
                               --------->AHL12(1)
                               <---------AHL20(2)
           --------->LBD16     <---------AHL12(1)
      <---------ANAC58         <---------AHL25(3)
      <---------ANAC58        --------->AHL25(1)
 --------->KAN1               --------->AHL20(2)
--------->AHL12(1)            <---------AHL25(1)
--------->AHL20(3)            --------->AHL12(3)
<---------AHL20(1)            <---------AHL12(3)
--------->AHL20(1)            --------->AHL25(3)
<---------AHL20(3)           <---------AHL12(2)
--------->AHL25(3)    <-----------GT1
<---------ARR11(3) --------->AHL12(2)
--------->ARR11(3) <---------AHL12(2)
<---------AHL25(3) <---------WOX13(2)
<---------AHL12(1) --------->WOX13(2)
--------->AHL20(2)<---------AHL20(2)
<---------AHL25(1)<---------AHL12(3)
<---------AHL25(2)<---------AHL20(3)
--------->AHL25(1)--------->AHL20(3)
<---------AHL20(2)--------->AHL25(1)
--------->AHL25(2)<---------AHL25(3)
-------->AHL12(1)--------->AHL12(1)
---------AHL12(2)<---------AHL20(2)
-------->AHL20(2)--------->AHL25(3)                                                     --------->DOF5.7(1)
---------AHL12(1)--------->AHL20(2)                                                   ---------->DOF2
->RVE1(2)<---------LBD16     --------->AHL12(2)     ------>ZmHOX2a(1)               --------->TOE2(3)
-------->AHL12(2)<---------AHL12(1)               ----------->RAV1(2)               <---------MYB59
-------->AHL12(3)<---------AHL25(1)     <---------At4g35610    <---------RVE1(2)   <---------ANAC55(2)
--->YAB1--------->AtLEC2    --------->YAB1       ------>ZmHOX2a(1)                 -----------------
---------AHL12(3)--------->AHL25(1)   <-----------RAV1(2)<-------TEIL         --------->YAB5
 
aaatatattccatgcggagattaatttacaaaaataaatctgcaggtgattcctcctgcattcatcgatatgttagagaaaccattacctaaagaagcgt  26759000
                            <---------ZAT14
                            --------->REM1(2)
                            --------->ZAT14
                           --------->ALFIN1
                         <---------ANAC46
                         <---------ANAC58
                         <---------ANAC58
                      <---------AtMYB61                         <---------ANAC46
                   <---------ARR14(2)                       --------->ARR11(3)
                   --------->ARR14(2)                       <---------GLK1(2)
                   <---------ARR11(2)                      --------->KAN1
                   --------->ARR11(2)                     ----------->ARR10
                   <---------MYB52(1)                     --------->DOF5.7(1)
                  <-------GAMYB                  <-------TEIL--------->GLK1(2)        <------MYB46(1)
                 <---------MYB46(3)             --------->CCA1(2)                     <------MYB83
                <---------DEAR3(1)             --------->ARR14(2)                   <--------P
               <---------ORA47(1)              --------->ARR11(3)                --------->DOF5.7(1)
              ------------>AtMYB77             <---------ARR14(2)                --------->DAG2
>AG        <---------------AtSPL3              <---------ARR11(2)              ---------->DOF2
 
tcttagtcgatgagattggacggttatggtgtgtagagactaaaacagaagatacagaagaaagattctgtgttttcttcacaaaaggttggcaaagttt  26759100
                                                                   --------->ARR11(2)
                                                            --------->GLK1(2)
                                                           <---------ARR11(2)
                                                           <---------GATA12
                                                     <---------ARR11(2)
                                                     <---------ARR14(2)
                                                     --------->GLK1(2)<---------YAB1
                                                     --------->ARR11(2)
                                        <---------At4g35610--------->ARR14(2)
                                        --------->ZAT2     <---------GLK1(2)                      --
                                        --------->At4g35610--------->ARR11(2)                   ----
                                        <---------ZAT2     --------->GATA12               <---------KAN1
                              <---------ANAC58   <------NtERF2     <---------ARR11(2)     ----------
                              <---------ANAC58  ------>NtERF2      <---------MYB52(1)    <---------GATA12
                              --------------------->WRI1   <---------ARR14(2)         <---------ANAC46
       --------->WOX13(1)<---------HSFC1(2)    <---------DEAR3(1) <-------GAMYB     --------->MYB52(1)
     <------ZmHOX2a(2)   --------->HSFC1(2) ----------->HVH21    --------->ANAC46  ----------->HVH21
 
cgcaaacgatcaatctcttgaatttggagacttccttgtcttcagctacgacggcgattccagattctccgttacgattttcgctaatgacggatgtaaa  26759200
                                                                  --------->AHL20(3)
                                                                  <---------AHL12(3)
                              ===========================HOX2a_HOX2a
                              ------>ZmHOX2a(2)                   <---------AHL20(3)
                             <------ZmHOX2a(2)                   <---------AHL25(2)
                             ============================HOX2a_HOX2a
                             --------->CCA1(2)                   --------->AHL12(1)
                            --------->GATA12                     <---------AHL12(1)
                            --------->AGP1                      <---------CCA1(1)
          <---------ANAC58  <---------GATA12                    <---------RVE1(1)
          <---------ANAC46  <---------RVE1(2)                  <---------ARR11(3)   --------->TOE1(2)
          <---------ANAC58  <---------AGP1                     --------->ARR11(3)  ------>ZmHOX2a(2)
         <------NtERF2      --------->ARR11(3)            --------->LBD16         <------ZmHOX2a(2)
     <------MYB46(1)        <---------ARR11(3)          <---------LBD16          --------->GATA12<--
    <---------AtMYB61   <---------ARR11(2)             --------->MYB52(1)        <---------GATA12<--
 <-----------RAV1(1)    --------->ARR11(2)            <---------ARR14(2)         --------->ARR14(2)
--------->ARR11(3)   --------->ANAC58                 <---------ARR11(2)         --------->ARR11(2)
<---------ARR11(3)   --------->ANAC58                 --------->ARR11(2)         <---------ARR11(2)
------->DOF5.7(1)   <---------LBD16                 ----------->ARR10            <---------ARR14(2)<
------>DOF2        ------->GAMYB                  <------ZmHOX2a(1)   <-----------GT1      <--------
->GT1<------MYB83 --------->MYB46(3)<---------GLK1(1) --------->ARR14(2)     <---------LBD16 <------
 
aaagatgttggtgtcgtctcaaccacggatagatctagggtttctcttgatgaggaagaaccggatgatatttttactaaaccggatcgtatgagagatt  26759300
<- Previous    Next ->

AGI:  At5g66970.1   
Description:  GTP binding. similar to signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C) [Arabidopsis thaliana] (TAIR:AT1G48900.2); similar to signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C) [Arabidopsis thaliana] (TAIR:AT1G48900.1); similar to Signal recognition particle 54 kDa protein 2 (SRP54) (GB:P49972); contains InterPro domain Signal recognition particle, SRP54 subunit, GTPase; (InterPro:IPR000897)
Range:  from: 26757671    to: 26758351    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g66980.1   
Description:  transcriptional factor B3 family protein. similar to transcriptional factor B3 family protein [Arabidopsis thaliana] (TAIR:AT3G06160.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN76392.1); contains InterPro domain Transcriptional factor B3; (InterPro:IPR003340)
Range:  from: 26758789    to: 26760052    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version