AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                         ------->TEIL
                                           <---------AHL20(3)
                                           --------->AHL20(3)
                                           <---------AHL25(2)
                                           --------->AHL25(1)
                                           <---------AHL25(1)
                                           <---------AHL25(3)
                                           <---------AHL20(2)
                                           --------->AHL25(2)
                                           --------->AHL20(2)
          <----------DOF2                  <---------AHL12(1)
         <---------ANAC58                  --------->AHL12(1)   <---------ANAC58
         <---------ANAC58                  --------->AHL20(1)   <---------ANAC58
       ------>NtERF2          --------->KAN4(2)         <---------AtLEC2           --------->GATA12
--------->ATHB12             --------->KAN1<---------AHL20(1) <---------YAB1       <---------RVE1(2)
---->ALFIN1    <---------AtLEC2   <----------DOF2   <---------AtLEC2        --------->AHL25(2)     <
->DOF2<---------RAP2.3(3)<---------ANAC46 --------->AHL25(3) ------->TEIL   <---------AHL25(2)     -
 
ggatgtttgggggcttttgcatcaagttgtgtttattcttttgtaataaattgctgcatgcatgtatgcttgtgttcaaaattttggatttgttttagag  20751000
                                                                       --------->ALFIN1
                                                                  <---------AHL25(3)
                                                                 --------->AHL20(2)
                                                                 <---------AHL25(1)
                               --------->DAG2                    --------->AHL25(1)
                              ---------->DOF2                    <---------AHL12(3)
                           --------->YAB1                        <---------AHL20(2)
                          <---------YAB5                        <---------AHL12(2)
                          <---------YAB1                        --------->AHL12(2)
                       --------->AHL12(1)                      <---------AHL12(2)
                       <---------AHL12(1)                   <---------AHL12(2)
                       <---------AHL20(2)                   --------->AHL12(2)
     --------->YAB1    --------->AHL20(2)                  --------->YAB1               --------->KAN1
    <---------YAB1    <---------AHL12(2)                   --------->AHL20(2)         <---------ANAC55(2)
---------ANAC55(2)    --------->AHL12(2)                 <---------WOX13(2)           --------->ANAC55(2)
-------->ANAC55(2) <---------AHL20(2)                    --------->WOX13(2)       <-----------HVH21
 
tcatgtgattatagtattctaagtaatttatcataaagtttgtcatatatacttaagtttaataaaaaataaatgtgtgtgaaaatgtcacatattggtg  20751100
                                                                           <---------AHL20(3)
                                                                       <---------AHL25(1)
                                                                       <---------AHL12(3)
                                                                       --------->AHL20(2)
                 <---------AHL12(1)                                    <---------AHL20(2)
                 --------->AHL12(1)                                    --------->AHL12(3)
                 --------->KAN1                                        --------->AHL25(1)  ---------
           <-----------HVH21                                       --------->AHL20(2)     ----------
          ----------->GT1      <-----------HVH21     <-----------GT1 <---------AHL12(2)  <---------ATHB12
      --------->AHL20(2)   <-------TEIL<---------ANAC55(2)        <---------YAB1  --------->ZAT18
 
tttttgttataaaatgtcaaatattctaagtacatgtcaaatacttaagtcatgtataacatgttttctattatttatatttatgtccaccaataaagca  20751200
                                                                                                   -
                             <---------WOX13(1)                                                    -
                           --------->ATHB12                                                        -
                       <---------AHL20(2)<---------AHL20(3)                                      <--
                      <---------AHL25(1) --------->AHL20(2)                                   ------
                      --------->AHL20(2) --------->AHL25(1)                                  <------
              <---------GATA12           <---------AHL25(1)                                 --------
              <---------ARR14(2)         <---------AHL12(3)                                 <-------
   --------->RVE1(2)  --------->AHL25(1) <---------AHL20(2)                                 --------
>DAG2         --------->ARR14(2)       <---------WOX13(1)      <---------AHL20(2)     --------->ANAC58
>DOF2         <---------GLK1(2)   <----------DOF2  <----------DOF2 --------->YAB1     --------->ANAC58
 
cttatatatcaaaaacagattgggattaaatgatagactttgatttatatgagacttttgcgacattttatcaaaatatgagaatagacaaacaatatca  20751300
                                                                                                <---
                                                                                               <----
                                                                                               -----
                                                                                              ------
                                                                                              ------
                                                                                              ------
                                                                                             -------
                                                                                             -------
                                                                             --------->RVE1(2)------
                                                                            ------>MYB83     <------NtERF2
                                                                            ------>MYB46(1)  -------
                                                                          <---------MYB59    -------
                                                                          --------->AtMYB61  -------
                                                                        ------>MYB46(1)     ------>NtERF2
                                                                       --------->ORA47(1)   *TSS----
                                                                      --------->MYB46(3)    <-------
                                                                     --------->DEAR3(2)    ---------
-------->ANAC58                                                <---------AHL12(2)        --------->ANAC46
-------->ANAC46                                               --------->AHL12(2)       --------->KAN1
-------->ANAC58                                              <---------AHL12(1)        <-----------GT1
-------ICU4                                       <----------DOF2  <-----------GT1     --------->CCA1(2)
--->YAB1          --------->DOF5.7(1)   --------->YAB1       --------->AHL20(2)       --------->ARR11(2)
---YAB1<------------CBF                 --------->TOE2(3)    --------->AHL12(1)       <---------ARR11(2)
->ARR11(3)       ---------->DOF2        --------->TOE1(3)    --------->AHL25(3)    <---------KAN1
--ARR11(3)  <---------------------WRI1 <---------YAB5    ----------->GT1------>MYB83  --------->ARR14(2)
->RVE1(2)<---------AtMYB61      <-------TEIL--------->WOX13(2)<---------AHL12(2)   --------->AHL20(2)
 
tcacgacatgaattggtcgataaggcccatgaaggtccagtaatcttaatgggctttatacagataaattataccgaccaaatcgattatatacgcgccg  20751400
                         <------NtERF2
                        ------>NtERF2
                        ----------->RAV1(1)
                       --------->RRTF1(2)
                       --------->RRTF1(3)
                       --------->RAP2.3(2)
                       --------->RAP2.3(3)
                       --------->DREB2C(2)
                       --------->RAP2.6(2)
                       --------->ATERF1(2)
                       --------->ANAC46
                       --------->DEAR3(1)
                       <---------ATERF1(2)
                      --------->ERF1
                      --------->RAP2.3(1)
<---------DOF5.7(1)   --------->ATERF1(1)
---NtERF2            <---------RAP2.3(1)
-----ATERF1(1)       <---------ATERF1(1)
->NtERF2 ------->GAMYB--------->ORA47(2)
--->RAP2.3(3)       --------->ANAC46
--->RAP2.3(2)    <---------ARR14(2)
--->DEAR3(1)     --------->KAN4(2)
-->ATERF1(1)     --------->ARR14(2)
-->RRTF1(1)      --------->ARR11(2)
--->RRTF1(3)     <---------ARR11(2)
-->RAP2.3(1)    <----------TaMYB80                                 --------->HSFB2a(2)        ------
-->DEAR4(2)     <---------KAN1                                     <---------HSFB2a(2) --------->CCA1(2)
-->ERF1  --------->AtMYB61                                         <---------HSFC1(1) --------->ARR14(2)
----->ATERF1(1) --------->KAN1                           --------->KAN1               <---------ARR11(2)
--ATERF1(1)    ---------->TaMYB80                   <----------ID1 --------->HSFC1(1) <---------ARR14(2)
>ANAC46 --------->MYB46(3)     --------->At4g35610  --------->ANAC46               <----------------
 
tcgtcttctcaaccatcgcatattcgccgccataagcagagagtttcacatataaacgaaaaattcccttcgagaagtctcaagtcgacgatatggagaa  20751500
                                                                                              <-----
                                                                                              ------
                                                                                           ---------
                  <---------DOF5.7(2)                                                      <--------
              --------->ANAC58                                                             ---------
              --------->ANAC58             <---------DOF5.7(1)                            ----------
        --------->LBD16                   ------>ZmHOX2a(1)                               ==========
       --------->HSFB2a(2)                <----------DOF2  <---------CCA1(2)            <-----------GT1
       <---------HSFB2a(2)  --------->ANAC58           <---------ANAC58         <---------ANAC58
  --------->KAN1  --------->MYB52(1)      <---------DOF5.7(1)                   <---------ANAC58
 <---------YAB5 --------->DOF5.7(2)  --------->WOX13(1)<---------ANAC58      <----------DOF2 ------>MYB83
--->MYB52(1) --------->ZAT18--------->ANAC58  <-----------GT1               <---------DOF5.7(1)
-----WRI1   <------ZmHOX2a(1)     --------->RVE1(2)    <---------ANAC46  <---------DOF5.7(1) ------>MYB46(1)
 
cggagacattccagaggacgctaacgagcgtaagcaaaatcaatccttttttcagttttcttgtagcttcaatcgctcttctttcttggtttaacctaat  20751600
                                                                                   -----------------
                                                     <---------At4g35610           -----------------
                                                     --------->At4g35610           --------------->AGL15
                                                  <---------KAN1                  ----------------->AGL1
                                                 --------->GATA12                --------->ZAT18
                                                 <---------GATA12                ------>NtERF2
                                                 --------->RVE1(2)           ------>NtERF2
                                                 <---------ARR11(2)         <---------ATERF1(2)
                                                 --------->ARR11(2)         --------->ATERF1(2)
                                                 --------->GLK1(2)<---------ARR14(2)            <---
                  ----------->GT1                <---------ARR14(2)  <---------ANAC58           <---
                <---------ANAC58             --------->YAB1       <---------RVE1(2)<---------------AGL15
                <---------ANAC46            <---------ATHB12      --------->ARR14(2)        <------ZmHOX2a(1)
                <---------ANAC58        ------>ZmHOX2a(1)         --------->GATA12----------------->AGL2
----WOX13(2) <--------P             <---------ARR14(2) --------->HSFB2a(2)--------->At4g35610  -----
--->WOX13(2)<---------ANAC58        --------->ARR14(2) <---------HSFB2a(2)<---------At4g35610  <----
>TOE2(3)    <---------ANAC58       <---------ZAT2--------->ARR14(2)  <---------ANAC58    --------->YAB1
-MYB59  <----------DOF2<---------WOX13(2) --------->WOX13(1) --------->RVE1(2)--------->ATERF1(1)
------>AGL15<-------GAMYB   <---------WOX13(1)  <---------GLK1(2) <---------GLK1(2)<----------------
------->AG <---------MYB46(3)    <-----------RAV1(2) --------->ZAT2--------->GLK1(2)    <---------ATHB12
====================================================================================================
 
tgggttttgttctttggttgcttgttaatagattgcccaggtcctcaatcagaatctgctggaaaatcagattcttgtgctggctgccctaatcaggaag  20751700
                            --------->ZAT2
                           <---------TOE2(2)
                           <---------TOE1(2)
                     ----------->HVH21            <----------DOF2
>AG                 <---------MYB59            <-----------GT1
>AGL1              --------->At4g35610         <---------AHL20(2)
------ANAC58       ----------->RAV1(2)       --------->WOX13(2)                                 <---
------ANAC58     <------ZmHOX2a(1)       <----------DOF2    <------MYB83                       <----
---->HSFC1(2)--------->MYB52(1)       <-----------GT1       <------MYB46(1)                   <-----
-----HSFC1(2)---------->DOF2<---------ZAT2 <---------AHL20(2)                  <----------DOF2<-----
-AGL1  <---------At4g35610<-----------RAV1(2)<---------WOX13(2)       <---------KAN1   --------->YAB1
=MADS_MADS  ------>ZmHOX2a(1)  <-------TEIL--------->AHL20(2)       <---------AtLEC2  <-------TEIL
 
cttgtgctactgctcctaaaggacctgacccaggttcgatttcactttaattactttgtggctaggtttttgaatgtctctgctttcgattcatacttag  20751800
                                                                                   ------->TEIL
                                                                                   --------->ARR14(2)
     --------->AHL20(2)                                                            --------->ARR11(2)
 <---------YAB1                                                                    <---------ARR14(2)
---ZmHOX2a(1)            <---------MYB46(3)                                       <---------CCA1(2)
-----YAB1                <-----------RAV1(1)                           <---------At4g35610
----TOE2(3)              <---------REM1(1)                             --------->At4g35610
----TOE2(2)        <-----------RAV1(1)     <XXXXXXXXXXXXXXXXXXXMIR866-3P      <----------DOF2<------
 
gattacaatttaaaacttggttttgttgttgttgcaatttctagttttgaagatgggttttgtatcaatgggttagatgagctttgtatcttctatttac  20751900
<- Previous    Next ->

AGI:  At5g50960.1   
Description:  nucleotide-binding family protein. similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G19540.1); similar to H0811E11.6 [Oryza sativa (indica cultivar-group)] (GB:CAC09490.2); similar to OSJNBa0081L15.19 [Oryza sativa (japonica cultivar-group)] (GB:CAE03157.2); contains InterPro domain Mrp, conserved site; (InterPro:IPR000808)
Range:  from: 20751393    to: 20753281    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version