AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                          ------>ZmHOX2a(1)
                                                                         --------->TOE2(3)         -
                                                                <------ZmHOX2a(2)                  <
                                                               --------->ARR14(2)          <--------
                                                               <---------GATA12         <-----------GT1
                                   --------->At4g35610         <---------ARR14(2)      <---------KAN1
                                   <---------At4g35610         --------->GATA12      <---------ARR14(2)
                            ------>ZmHOX2a(2)                  <---------ARR11(2)    --------->ARR14(2)
                    --------->GLK1(2)                          --------->ARR11(2)    --------->ARR11(2)
      --------->At4g35610 <---------GATA12                     <---------ARR11(3)    <---------ARR11(2)
      <---------At4g35610 --------->GATA12           <-------TEIL <---------ALFIN1 --------->LBD16 -
   <---------YAB5   <---------ARR11(3)        <----------DOF2  --------->ARR11(3)<---------LBD16   -
  <---------WOX13(2)--------->RVE1(2)        --------->YAB5    --------->AGP1    --------->At4g35610
  --------->WOX13(2)--------->ARR11(3)       <---------DOF5.7(1)=================HOX2a_HOX2a  <-----
------>YAB5        <---------GLK1(2)        <---------ATHB12   --------->RVE1(2) <---------At4g35610
 
tgcttaatcaactgcttcttcaaaatctcgatctcttcagcagtccaatctttagtttcattcacagatccactctccttagactgcggaatcaccactt  18423400
                                                                                                   <
                                                                                                  --
                                                                                         <---------ARR11(2)
                                                                                         --------->ARR11(2)
                                     <---------KAN1                                      --------->GATA12
                                    <---------GLK1(2)                                    <---------ARR14(2)
                              <---------LBD16                                            --------->ARR14(2)
             <---------At5g28300   <------NtERF2                                      ------>ZmHOX2a(1)
            <---------WRKY38(1) <---------LBD16                          <---------At5g28300  ------
    --------->HSFC1(2)        <---------RAP2.3(2)               =============================HOX2a_HOX2a
--------->ANAC46--------->ZAT14------>NtERF2                    ==========================HOX2a_HOX2a
-------->HSFB2a(2)            <---------RAP2.6(2)               ------>ZmHOX2a(2)     --------->LBD16
---------HSFB2a(2) --------->At4g35610<---------KAN1          --------->GATA12      ----------->RAV1(2)
-ALFIN1--------->ZAT14   <---------KAN1                  <----------DOF2<-----------GT1  <---------GATA12
----->ZmHOX2a(1)--------->LBD16--------->LBD16          <---------DOF5.7(1)   --------->GLK1(1)   <-
-------->LBD16 --------->DEAR3(1)<---------ANAC46     ------->TEIL  --------->KAN1 ------>ZmHOX2a(1)
-----DOF2 <-----------HVH21  <---------LBD16<----------DOF2   <---------GATA12<---------GLK1(1)  <--
 
tcctcgaaacttcagtcaccgcagaagcattttccggcggattatcgctcttcgtcgaacctttagatcgcttattcaccgatttcctcctggattcacg  18423500
                                                       ------->GAMYB
                                                       ----------->HVH21
                                                       --------->DEAR3(1)
                                                      --------->MYB46(3)
                                                      --------->DEAR3(2)
                                                    --------->ARR11(2)
                                                    <---------ARR11(2)
                                                    <---------ARR14(2)
                                                    --------->MYB52(1)
                                                    --------->ARR14(2)
                                             ----------->HVH21
                                            ------>ZmHOX2a(2)
                                           --------->At4g35610
                                           --------->CCA1(2)               <---------MYB52(1)
                                           <------ZmHOX2a(2)              --------->LBD16
                                          --------->ARR14(2)    <---------KAN1
                                          <---------ARR11(2)   <---------ARR11(1)
      <---------LBD16                     --------->ARR11(2)   <-----------ARR10
      --------->LBD16                     <---------ARR14(2)   <---------GATA12
     <---------ANAC46   --------->ARR11(2)<---------ARR14(3)   --------->ARR14(2)
     <---------ANAC58   <---------ARR11(2)--------->ARR11(3)   --------->GLK1(2)
     <---------ANAC58   --------->ARR14(2)--------->AGP1       <---------ARR14(2)              -----
 --------->KAN1         <---------ARR14(2)<---------GATA12     <---------ARR11(2)  --------->ZAT2  -
<---------MYB52(1)      --------->GATA12  --------->GATA12     --------->GATA12    <---------ZAT2<--
-------GAMYB            <---------GATA12  <---------AGP1       ------->TEIL<-----------HVH21 -------
------->MYB52(2)        --------->GLK1(2) --------->RVE1(2)    --------->RVE1(2)   <---------STY1(2)
--->KAN1                ------->TEIL      <-----------ARR10------>NtERF2<---------LBD16 <------ZmHOX2a(1)
--------MYB46(3)       <---------CCA1(2)  <---------ARR11(3)  <---------CCA1(2)    --------->STY1(2)
-----TEIL   --------->YAB5                --------->ARR14(3)  <---------ARR14(1) --------->ZAT18----
 
ttcgttatccgtggatgactcatcgtgaatctgttctggctccaagatctgaccataaccgacgcgaatcttacctccggtgagcgagctaggagcgaaa  18423600
                                                     <-------TEIL
                                                   <---------GLK1(2)
                                                   <---------RVE1(2)
                                                   <---------ARR14(2)
                                                   <---------GATA12
                                                   <---------ARR11(2)
          --------->DOF5.7(1)                      --------->GATA12
       <------ZmHOX2a(1)                           --------->ARR11(2)
----------->HVH21                                  --------->ARR14(2)
--------->DEAR3(1)        --------->YAB1          --------->KAN1
---->DOF5.7(1)      --------->ANAC58             ----------->ARR10
-------->DEAR3(2)   --------->ANAC58           <-------TEIL                       --------->YAB5
----ZmHOX2a(1)     --------->GLK1(1)        <------MYB83                         <---------YAB1
--->DOF2---------->DOF2  <---------YAB1     <------MYB46(1)              ----------->GT1
----->DOF5.7(1)   ---------->DOF2          <---------TOE1(2)        <------ZmHOX2a(1)
 
ggaccgacgaggaaagagagggaaagccataatagtagcgatttggcaggttcagattcgaagtagaagaaggagagagataatatgatgagggagattg  18423700
                                                      <---------ANAC58
                                                      <---------ANAC58
                                                      --------->TGA1a
                                                      <---------O2
                                                      <---------TGA1a
                                                    ------>NtERF2>>>>>>>>>TBF1            <---------KAN1
                                                   --------->DEAR3(1)                    <---------GATA12
                                                   --------->ANAC46                      ------->TEIL
                  <---------ANAC58         <<<<<<<<<TBF1--------->ALFIN1                 <----------
                  <---------ANAC58      <<<<<<<<<TBF1 <---------ANAC46                   --------->GLK1(2)
              ==================================================bZIP_DOF                 <---------ARR14(2)
              ---------->DOF2      <---------GLK1(2)--------->LBD16    <------ZmHOX2a(1) --------->ARR14(2)
    <---------GATA12         --------->GLK1(2)   ------>ZmHOX2a(1)    <----------ID1    <---------ARR14(1)
 
agacggagattgaaatgaaaagcttgttagggattctagcttcttcttcttcctccgccgtgtgagaagaagaaggacgagattggaaaacgaatctagg  18423800
                                                                              --------->RVE1(2)
                                                                              --------->ARR11(3)
                                                                              <---------ARR11(3)
                                                                             --------->CCA1(1)
                                                                             --------->RVE1(1)
                                                                            --------->AHL12(1)
                                                             <---------AHL25(3)
                                              --------->At4g35610           <---------AHL12(1)
                                     --------->ZAT14      <---------AHL12(2)<---------AHL25(3)
                             <-------GAMYB    <---------At4g35610          <---------AHL12(2)
                            <-----------RAV1(1)          --------->AHL20(2)<---------AHL25(1)
                    <-----------RAV1(1)      --------->GLK1(2)             --------->AHL25(2)
              --------->RVE1(2) --------->ZAT18         --------->AHL20(2) --------->AHL12(3)
-ARR10      --------->DOF5.7(1) *TSS <---------ZAT14------------>CBF       --------->AHL20(2)
 
cctgtcttcgtcgaaaaaatccattgttgctctgttgcactgtagaagaagctgaaacaataaataaaacttagaaaaaaaaatctcagaaataagtgtt  18423900
                                                                                                   <
                                                                                                   -
                                                                                               <----
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                                   --------->At4g35610      --------
                                                                   <---------KAN1           <-------
                                                              <-----------GT1               <-------
                                                        --------->AHL20(3)                  --------
                                                        --------->AHL12(3)                  <-------
                                 <---------RVE1(2)      <---------AHL20(2)                  --------
                         <---------GLK1(2)              <---------AHL25(2)                  --------
                         --------->ARR11(3)             --------->AHL20(2)                  <-------
                 --------->ARR14(2)                     <---------AHL20(3)                  --------
                 <---------ARR11(2)                     <---------AHL25(1)                 ---------
                 <---------ARR14(2)                <---------AHL20(1)                      ---------
                 --------->ARR11(2)                --------->AHL20(1)                     <---------KAN1
             <-------TEIL<---------ARR11(3)       --------->AHL12(3)                     ------->TEIL
        ---------->DOF2----------->ARR10---------->DOF2 --------->AHL25(1)        --------->KAN1  --
   <----------DOF2  --------->ANAC46 ----------->GT1    <---------AHL25(3)     ----------->GT1 -----
 
tttgggcttttgaaagtccatatacgaagatttttgggtattgtaaagcccatatatattaaaatttagcatatgacaaaattggttatacgaattttaa  18424000
                                  --------->AHL12(2)
                                  <---------AHL12(2)
                                 --------->AHL20(2)
                                 <---------AHL20(1)
                                 --------->AHL20(1)
                                 --------->AHL25(3)
                                 --------->AHL25(2)
                                 <---------AHL20(2)
                                 <---------AHL25(2)
                                 <---------AHL25(3)
                                 <---------AHL25(1)
                                 --------->AHL12(3)
                                 <---------AHL12(3)
                                 --------->AHL25(1)
                                --------->AHL12(1)
                                <---------AHL12(1)
                                --------->AHL20(2)
                                <---------AHL25(1)
                                <---------AHL20(2)
                                --------->AHL25(3)
                                <---------AHL25(3)
                                <---------AHL25(2)
                                --------->AHL25(1)
                                --------->AHL12(3)
                                <---------AHL12(3)
                              --------->WOX13(2)
                             <---------AHL25(3)
                            <---------AHL20(1)
   --------->AHL12(2)       --------->AHL20(1)
   <---------AHL12(2)       <---------AHL25(1)
   <---------WOX13(2)       --------->AHL12(3)
   --------->WOX13(2)       --------->AHL25(3)
 <---------AHL20(2)         <---------AHL25(3)
---------WOX13(2)           <---------AHL12(1)
-------->WOX13(2)           <---------AHL25(2)
-----WOX13(2)               --------->AHL25(2)
-->AHL20(2)                 <---------AHL12(3)                  ==========================HOX2a_HOX2a
---YAB1                     --------->AHL20(3)                  <------ZmHOX2a(2)
---AHL20(2)                 <---------AHL20(3)                 --------->GATA12
->AHL12(3)                  --------->AHL25(1)                 <---------GATA12
--AHL25(2)                  --------->AHL20(2)         --------->KAN1
--AHL20(2)                  --------->AHL12(1)        --------->ZAT18
->AHL25(1)                  <---------AHL20(2)        --------->ZAT14
--AHL12(3)                 --------->AHL25(3)         <---------ZAT18
->AHL20(2)                <---------WOX13(2)          <---------ZAT14       <---------RVE1(2)
->AHL25(3)             <---------MYB52(1)           --------->REM1(2) <---------ARR11(2)
--AHL25(1)            --------->TOE2(3)          <---------ANAC58     <---------ARR14(2)
->AHL25(2)            --------->TOE1(3)   <---------ZAT6 --------->ANAC46 <---------ZAT6
>AHL12(2)   <---------KAN1--------->WOX13(2)   --------->DOF5.7(1)    --------->ARR14(2)
>YAB1     <---------ZAT6  --------->AHL12(2) ---------->DOF2   <---------ARR11(3)
--------->GT1 --------->ANAC58<---------WOX13(2) <---------ANAC46=========================HOX2a_HOX2a
---->WOX13(2) --------->ANAC58<---------AHL12(2) <---------ANAC58------>ZmHOX2a(2) <------ZmHOX2a(1)
 
ttagttaattttagagtaagcaaacccttaattaattaaattttagtggaaagcgtgtacactcgagatcgcagatagagatagtaggactcagagaaga  18424100
                                                                       --------->ANAC58
                                                                       --------->ANAC58
                                                                       --------->ANAC46
                                                                      --------->SPL7(1)
                                                                  --------------->AtSPL8
                                                                  <---------------AtSPL8
                                                                  <---------------AtSPL3 <---------TOE2(3)
                                                              ------->MYC3    <---------AHL20(2)  <-
                                                              <-------MYC3    --------->AHL25(1)  --
         --------->YAB1                 --------->ANAC58     --------->TGA1a  --------->AHL25(2) ---
         <---------ICU4================================================bZIP_DOF         <-----------GT1
        <---------ATHB12          --------->MYB46(3)         <---------TGA1a  --------->AHL12(3) ---
        <---------YAB5 <----------DOF2  --------->ANAC58     =======================================
      --------->YAB1  <---------DOF5.7(1)                   <---------TOE1(2) <---------AHL25(2)<---
 
ttgtgccactaatcatgctcttgagcctttctgttcaacaacgaagcaattgcagagaaatcacacgtttgtgtacgacattttttttttttaacgtcga  18424200
                                       --------->AHL12(1)
                                       <---------AHL25(2)
                                       --------->AHL20(1)                                        <--
                                       --------->AHL20(3)                                       <---
            <---------RVE1(2)          <---------AHL20(3)                                       <---
      --------->MYB52(2)               --------->AHL25(2)                                       <---
    <--------P                         <---------AHL20(1)                                       ----
    <---------MYB52(1)                 --------->ARR11(3)                                       ----
  <---------MYB46(3)               --------->YAB1                                --------->DOF5.7(1)
--------AHL20(2)                  ----------->GT1                               --------->DAG2 <----
------->ATHB12                 <---------AHL20(2)                               --------->DOF5.7(1)
------>AHL25(3)            --------->YAB1             --------->DOF5.7(1)      ---------->DOF2 -----
------>AHL20(2)           <---------YAB1  <---------YAB1  ----------->GT1      --------->DOF5.7(1)
=======bZIP_DOF           <---------AHL20(2)      ----------->GT1         ----------->GT1      <----
-------DOF2 <---------AHL20(2)--------->AHL20(2)<---------LBD16      <------ZmHOX2a(1) ----------->GT1
 
tttattggttagttttatattgcaactatattataaaatgaaaatattgttgacggaaaaatggaaattttaggagccagaaaaaagggaaggaaacaat  18424300
<- Previous    Next ->

AGI:  At5g45420.1   
Description:  myb family transcription factor. similar to DNAJ heat shock N-terminal domain-containing protein / cell division protein-related [Arabidopsis thaliana] (TAIR:AT3G11450.1); similar to hypothetical protein OsI_026897 [Oryza sativa (indica cultivar-group)] (GB:EAZ05665.1); contains InterPro domain Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609); contains InterPro domain SANT, DNA-binding; (InterPro:IPR001005); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Myb, DNA-binding (InterPro:IPR014778)
Range:  from: 18421296    to: 18423833    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version