AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                         --------->LBD16                 <---------ATERF1(2)
                         --------->At5g28300             --------->DEAR3(1)
                        <---------ANAC46                 <---------DEAR3(1)
                        <---------O2                     --------->ATERF1(2)
                        --------->TGA1a                  --------->RAP2.3(2)
                        --------->O2                     --------->RRTF1(2)
                        <---------TGA1a                  --------->RAP2.3(3)
                       <------NtERF2                     <---------ALFIN1
                      ------>NtERF2                      --------->RRTF1(3)
                      --------->LBD16                   --------->DEAR4(2)
                     --------->ANAC46                   --------->ERF1
                    --------->MYB46(3)                  --------->RAP2.3(1)
                    <---------MYB55(2)                  <------NtERF2
                    <---------LBD16                     --------->ATERF1(1)
                  <---------ARR14(2)                    --------->RAP2.6(1)
                  --------->ARR11(2)                    --------->RRTF1(1)                         <
                  <---------ARR11(2)              --------->DEAR3(1)    <----------DOF2           <-
                  --------->ARR14(2)            ------>NtERF2<---------ATERF1(1)                  --
             <---------ANAC46                  <---------ALFIN1----------->RAV1(1)              ----
            <---------DEAR3(1)               <-----------HVH21--------->RAP2.6(1)             ------
           <---------LBD16                   ------>NtERF2--------->At4g35610                <------ZmHOX2a(2)
        --------->At4g35610                 --------->ANAC46<---------ATERF1(2)             --------
        <---------At4g35610                 ----------->HVH21------>NtERF2                  --------
       <-----------RAV1(1)<---------MYB52(1)<---------ETT(1)--------->ATERF1(2)             <-------
   <-------MYC3   ------->TEIL         --------->KAN1   --------->ORA47(2)                  <-------
   ------->MYC3 <---------ZAT18        --------->YAB5  <---------DEAR4(2)                   <-------
<---------ALFIN1--------->ZAT14       <---------YAB5   <---------ATERF1(1)               ------>ZmHOX2a(2)
-----HSFB2a(1)  <---------SPL7(1)     <---------KAN1   <---------RAP2.3(1)   <---------ZAT6 --------
---->HSFB2a(1) --------->ALFIN1    <------ZmHOX2a(1) --------->SPL7(1)<-------TEIL   <---------YAB1-
cttccacgttttgctgcggtgtacccgccgtgagtagaggaatcactccgacaccgagcgccgccgccgcagctgcattactgttcatatgatcggatcc  3989000
      <---------LBD16                                                          --------->RRTF1(1)
  --------->ZAT6                                                               --------->ERF1
---------GLK1(1)                                                               --------->DEAR4(2)
--------ARR11(3)                                                              <---------ATERF1(1)
------->ARR14(2)                                                              ------>NtERF2
----->LBD16                    <------NtERF2                                  <---------RAP2.3(1)
>ZmHOX2a(2)        ----------->GT1                              --------->AtLEC2--------->ANAC46
->GATA12------>NtERF2         --------->LBD16                --------->MYB46(3)--------->ORA47(2)
->ARR14(2)         <---------MYB46(3)  --------->ANAC46      <---------ATHB12--------->DEAR3(1)
--ARR14(2)        <---------AtMYB61    --------->ANAC58     ------>MYB46(1)  <---------DEAR3(1)
--GATA12--------->LBD16<---------RVE1(2)                    ------>MYB83   <---------ATERF1(1)   <--
--ARR11(2)     <-----------RAV1(1)     --------->ANAC58     -------->P    --------->ANAC46       <--
->ARR11(2) <----------DOF2  <---------LBD16 <---------KAN1--------->AtMYB61<-----------HVH21    ----
-------->GLK1(1)  --------->ALFIN1 ----------->RAV1(1)    --------->MYB46(3)--------->ATERF1(1)<----
agatatcactccggcgttctggtggtgataagccggagcaacaaggaatacatctcttagaccaaccatgcccatctccgtcgccgccgccgaagaaggt  3989100
                 ------>ZmHOX2a(2)       <---------ABI4(1)
                <------ZmHOX2a(2)        --------->RAP2.3(1)
               <---------ARR14(2)        <------NtERF2
               <---------ARR11(2)       <---------ERF1
               --------->GATA12         <---------RAP2.3(1)
               --------->RVE1(2)        <---------RAP2.6(1)
               --------->ARR11(2)       --------->LBD16
               --------->ARR14(3)       <---------DEAR4(2)
               --------->ARR14(2)       <---------ATERF1(1)
               <---------GATA12         ------>NtERF2                               <---------ARR14(2)
               <---------ARR14(3)       <---------ORA47(2)                          <---------ARR11(2)
               <---------ARR11(3)      <---------RAP2.3(2)                          --------->ARR11(2)
   --------->MYB52(1)       --------->ICU4--------->ATERF1(2)                       --------->ARR14(2)
   <---------ARR11(2)       <---------YAB1<---------DEAR3(1)                  <---------ANAC46
   --------->ARR11(2)  --------->ANAC58--------->ATERF1(2)                  --------->MYB52(1)
  ----------->HVH21    --------->ANAC58<---------ATERF1(2)            --------->LBD16
 <---------RAP2.6(3)  --------->SPL7(1)<---------DEAR3(1)         --------->AtMYB61<------ZmHOX2a(1)
 <---------SPL7(1)<---------LBD16      --------->DEAR3(1)        <---------MYB55(2)=================
--------->RAP2.6(2) --------->LBD16   --------->ATERF1(1)        --------->MYB46(3)=================
----MYB83      --------->ARR11(3)     <---------LBD16--------->ZAT2  <---------ANAC46 --------->MYB46(3)
----MYB46(1)  --------->HSFB2a(1)   --------->ANAC58 <---------ZAT2  --------->DEAR3(1)
----->MYB59   <---------HSFB2a(1)   --------->ANAC58 <---------At4g35610   ----------->HVH21
----P ------->GAMYB--------->LBD16 --------->SPL7(1) --------->At4g35610   ----------->TGA1
aggccgtaacggacagaagatcccggaggccatgatggaacgccggcggcgacggaagctgagcctaaaccaccgtggatgacggaggaaccagcattga  3989200
                  <-----------HVH21                                        <---------O2
                  ------>NtERF2                                            <---------TGA1a
              <---------DEAR3(1)                                     --------->ARR14(2)
             ------>ZmHOX2a(1)                               <---------ABI4(2)
           ------>ZmHOX2a(2)                                 --------->ZAT18
          <------ZmHOX2a(2)                    <------NtERF2--------->ANAC58
         <---------RVE1(2)                    <---------RAP2.6(3)    --------->GLK1(2)
         <---------ARR11(2)                   ------>NtERF2 --------->ANAC46
         --------->ARR11(3)                  --------->DEAR3(1)      <---------GATA12
         <---------ARR11(3)                 --------->RAP2.3(1)      <---------ARR11(2)
         <---------GLK1(2)             <---------O2      <---------WRKY12  <---------bZIP60(1)
         --------->ARR11(2)          <-----------HVH21   <---------WRKY38(1)    <-------GAMYB
         --------->ARR14(2)        <---------YAB5     <---------DEAR3(2)   --------->O2
         <---------GATA12          <------NtERF2      <------MYB46(1)--------->ARR11(2)
         --------->GATA12        --------->bZIP60(1) <---------MYB46(3)    --------->bZIP60(1)
         --------->AGP1          <---------ANAC46    <---------DREB2C(2)   =============MYC_MYB
         <---------ARR14(2)      <---------bZIP60(1) <---------DEAR3(1) ----------->HVH21
         --------->ARR14(3)     <------NtERF2--------->RAP2.6(2)     <---------ARR14(2)        -----
        --------->GLK1(1)   <------MYB46(1) <---------RAP2.6(2) <---------LBD16<---------DEAR3(2)
        --------->KAN1--------->ANAC58<------NtERF2<-----------HVH21<---------GLK1(2) --------->KAN1
        <---------GLK1(1)  <---------AtMYB61--------->ATERF1(1)--------->MYB52(1)     <---------KAN1
       ----------->ARR10  <--------P<---------DEAR3(1)<------MYB83--------->LBD16   <---------RVE1(2)
=================HOX2a_HOX2a<------MYB83   <---------ATERF1(1) ------->TEIL--------->TGA1a  ------>NtERF2
==================HOX2a_HOX2a --------->ALFIN1<------NtERF2 --------->ANAC58  <---------DEAR3(1)   <
aaccaagagagagatcctcggtggcacgggaaggtgtcgtcgtcgtggccgcccagtcggtgaacgcaccggaatccgacgtcggtagattatgcctcct  3989300
                                              <---------AHL25(1)           ---------->DOF2
                                              --------->AHL25(1)       <---------AHL12(2)
                                              --------->AHL20(1)     --------->AHL20(2)
                                              --------->AHL20(2)     --------->AHL25(1)
                                              <---------AHL12(3)     --------->AHL20(3)
              <---------YAB1             --------->AHL20(3)<---------AHL25(3)
         <---------ZAT2                  --------->AHL20(1)--------->AHL25(3)
         <---------At4g35610             --------->AHL20(2)<---------AHL25(1)       <---------ZAT14
         --------->At4g35610             <---------AHL20(2)<---------AHL12(3)       --------->ZAT14
         --------->ZAT2                  <---------AHL12(3)--------->AHL20(2) <-----------HVH21
       <-----------RAV1(2)               <---------AHL25(2)<---------AHL20(2)--------->ANAC46
       <---------ALFIN1               --------->YAB1  <---------AHL20(3)  <---------AHL25(3)
     ----------->RAV1(1)      --------->RVE1(2)   --------->AHL20(2) <---------AHL20(3)      >>>>>>>
->ZmHOX2a(1)--------->YAB5--------->TOE2(3)   --------->AHL20(3)     <---------AHL12(3) ---------->DOF2
---------REM1(1)          --------->TOE1(3)   <---------AHL20(2)----------->GT1     --------->At4g35610
cgttgtagccacagctgattataccaaaaccctaatcccaaaaataaaataaaataaaaaaatttaatagaaaaaaataaaagtcacagcacaaagctcc  3989400
                        <---------GATA12                <---------RVE1(2)
                        --------->ARR14(2)              --------->ARR14(2)
                        --------->RVE1(2)               <---------ARR14(2)
                        <---------ARR14(2)              --------->ARR11(2)
                        --------->GLK1(2)               <---------ARR11(2)
      *TSS              <-----------ARR10   --------->DOF5.7(1)<---------WOX13(1)
   <---------MYB59      --------->GATA12  ---------->DOF2<------ZmHOX2a(2)
 ------->TEIL      --------->ANAC46 <---------RVE1(2)   --------->GATA12
 <-------TEIL <---------GATA12    <---------YAB1        <---------GATA12                  <---------GATA12
>>>>>>>>>>LFY --------->GATA12  <----------DOF2         ------->TEIL ----------->TBP      --------->RVE1(2)
aatgtacataacccataaatctacacaaatctgagctttgatagagaaagatgaagatggatcctaattgctataaaaccaaaaacaaaaacaaatccaa  3989500
            --------->GATA12          --------->ANAC58
            <---------ARR11(3)        --------->ANAC58
      <-----------GT1                 --------->ANAC46
   <---------AHL12(1)               <---------ALFIN1              <---------DOF5.7(1)
  <---------RVE1(1)            --------->At4g35610   --------->ZAT14
 <---------RVE1(2)             <---------At4g35610   <---------ZAT14                            ----
 --------->ARR11(3)            --------->ZAT2   ---------->DOF2  <----------DOF2               -----
 <---------GLK1(2)       --------->RVE1(2)      --------->DOF5.7(1)             ------>ZmHOX2a(1) --
 <---------ARR11(3)      <xxxxxxxxxxxxxxxxxxxxsmallRNA(se3)     <---------DOF5.7(1)    --------->RVE1(2)
aatagattttttcgaaatcttctgtcactatctctgctcacacgcagtggaaaaagaacactgcgactctttttcttcgcttcctctctctatctaacaa  3989600
           <---------TOE1(2)              <-----------RAV1(1)
          ------>ZmHOX2a(1)             <---------ANAC58                               <----------DOF2
          ================================HOX2a_HOX2a                                 <---------DAG2
      --------->ARR14(2)                <---------ANAC58                           <-----------GT1
      --------->ARR11(2)            <----------DOF2                           <----------DOF2
      <---------ARR11(2)           ------>ZmHOX2a(2)                         ------>ZmHOX2a(2)
     <---------MYB52(1)            <---------DOF5.7(1)                       <---------DOF5.7(1)
    <---------DOF5.7(1)          --------->ARR11(3)         <----------DOF2<---------RVE1(2)
------->RAV1(2)                  <---------ARR11(3)   <---------RVE1(2)    --------->ARR11(3)
---->GLK1(2) <----------DOF2     <---------RVE1(2)   <------------------------ANAC81  <---------DOF5.7(1)
--------->HVH21            --------->MYB46(3) <---------At4g35610          <---------ARR11(3)
tctgacccgtttcctactttccttctcttaacaactgatcttttcttgttgctgtctgattttctttggtttcttcttgatcttttttacctttttaaaa  3989700
                               <---------GLK1(2)               <---------ICU4         --------->DOF5.7(1)
                            <---------HSFB2a(2)                --------->YAB1   --------->ZAT14
                            >>>>>>>ZML2            <---------CCA1(2)<---------YAB5  ---------->DOF2
                     <---------ANAC58      --------->KAN1     --------->ICU4 <---------At4g35610
               <---------AtMYB61      <---------ANAC46        <---------YAB5 --------->At4g35610----
         ------->TEIL<---------ANAC58 <---------ANAC58       --------->WOX13(2) <---------ZAT14 <---
      <---------ANAC46      --------->HSFB2a(2)  ------>ZmHOX2a(1)--------->YAB1--------->At4g35610
   --------->ALFIN1  <---------ANAC46 <---------ANAC58       <---------WOX13(2)------->GAMYB  <-----
acagaagtggtgtatgttttggtttcttgttctagattgtttcgtcttgttcctgtctctctctaattatcatcatggacaactgcagaaagatagaata  3989800
                        --------->AHL25(1)                   <---------ICU4
                       <---------AHL20(2)                    --------->YAB1
                       --------->AHL20(2)                    -------->HAHB4
                       --------->AHL12(3)                   <---------YAB1
                       <---------AHL25(2)                  <---------AHL20(3)
                       --------->AHL25(3)                  --------->AHL20(3)
                       <---------AHL12(3)                  <---------AHL25(2)
                       <---------AHL25(1)                  --------->AHL25(2)
                       <---------AHL20(3)                 --------->YAB1
                       --------->AHL20(3)                <---------YAB1
                     <---------WOX13(2)          <---------AHL25(2)
                     --------->WOX13(2)          <---------AHL20(2)
                    --------->AHL12(2)           --------->AHL20(2)
                   --------->AHL25(3)            --------->AHL20(3)
                   <---------AHL20(2)            <---------AHL20(1)
                   --------->AHL25(1)            --------->AHL12(3)
                   <---------AHL25(1)            --------->AHL25(3)
               <------MYB46(1) <---------AHL20(2)<---------AHL20(3)
       --------->AHL12(1)     <---------AHL12(2) --------->AHL25(2)
      --------->AHL12(2)<---------AHL25(1)  --------->AHL25(3)   --------->At4g35610
 ----------->GT1<<<<<<<<<<MYB80--------->AHL25(3)<---------AHL25(3)                                <
----->DAG2     <------MYB83--------->AHL12(2)    --------->AHL25(1)               ------->MYC3     <
------TOE2(3)  <---------MYB46(3)   <---------AHL20(2)<---------AHL20(2)          <-------MYC3    <-
----KAN1   <-----------RAV1(1)--------->AHL12(2) <---------AHL25(1)  ---------->DOF2  <-----------GT1
aggcaagtgaatttttgttggtttaattttattttttattttatagttttattttattttataataatagctcaaagaaatggcacatgataccttcttc  3989900
<- Previous    Next ->

AGI:  At5g12330.1   
Description:  LRP1 (LATERAL ROOT PRIMORDIUM 1). similar to SRS7 (SHI-RELATED SEQUENCE 7) [Arabidopsis thaliana] (TAIR:AT1G19790.1); similar to SRS7 (SHI-RELATED SEQUENCE 7) [Arabidopsis thaliana] (TAIR:AT1G19790.2); similar to hypothetical protein [Vitis vinifera] (GB:CAN59914.1); contains InterPro domain Lateral Root Primordium type 1, C-terminal (InterPro:IPR006511); contains InterPro domain Zinc finger, Lateral Root Primordium type 1 (InterPro:IPR006510); contains InterPro domain Protein of unknown function DUF702 (InterPro:IPR007818)
Range:  from: 3987376    to: 3989407    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version