AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                ----
                                                                 --------->RVE1(2)             -----
                                                          <---------MYB59                  <--------
                                                          ------>ZmHOX2a(2)                <--------
                                                         <------ZmHOX2a(2)                 <--------
                                                        --------->ARR11(3)                 ---------
                                                        <-----------ARR10                  <--------
                                                        <---------ARR11(3)                 ---------
                                                        --------->RVE1(2)                  <--------
                                                        --------->ARR11(2)                 ---------
                                                        <---------AGP1                     <--------
                                                        <---------ARR11(2)                 ---------
         <---------YAB1                                 <---------ARR14(2)               <---------AHL12(2)
         <---------YAB5                                 --------->GATA12                --------->YAB1
      <---------AHL20(2)             <-----------HVH21  --------->AGP1                  --------->YAB5
    ------->TEIL       <---------AHL20(2)               <---------GATA12               <---------ATHB12
 <---------YAB1        --------->AHL20(2)               --------->ARR14(2)          --------->YAB5
--------YAB1         --------->WOX13(2)                <---------CCA1(2)          --------->GLK1(2)
------ZAT6           <---------WOX13(2)             <---------ZAT2    <---------GLK1(2)<---------ATHB51
--MYB52(1)   ------>ZmHOX2a(2)<---------KAN1        <---------At4g35610           --------->RVE1(2)
 
tattatgaatttatgatccagtctaatttaagaacatatgggtcagttttctgcgagcagatctaacttatcaaattctctcaagaatcaataataaaat  2641300
      --------->MYB46(3)
    ----------->RAV1(1)
----->TOE2(3)
------>GT1
-AHL25(3)                                          XXXXXXXXXXXXXXXXXXXX>MIR166A-G
-AHL25(1)                                          -------->P
-AHL25(2)                                         <-----------GT1
>AHL25(1)          <---------AHL12(2)           <---------MYB52(2)                <-----------HVH21
-AHL20(1)         <---------AHL12(1)--------->AHL20(3)                   --------->RVE1(2)
>AHL20(2)         --------->AHL12(1)--------->AHL20(2)                   ------>MYB46(1)
-AHL20(3)--------->ARR14(2)         <---------AHL12(3)                   ------>MYB83
>AHL20(1)--------->RVE1(2)          <---------AHL20(3)                   --------->ARR11(2)
-AHL20(2)<---------GATA12           --------->AHL12(3)                 <---------MYB59
>AHL20(3)--------->GATA12    ----------->GT1  --------->RVE1(2)   ------>ZmHOX2a(1)           <-----
 
gttaatccaacaaatctacaaaaatttgcaagtgtttaaaaatataaaacatctaaccagacttcaatcctcgacctatctactatgtcaaatagacatg  2641400
                                                                                                  <-
                                                                                                ----
                                                                                                <---
                                                                                                >>>>
                                                                                                >>>>
                                                                                               <----
                                                                                               -----
                                                                             --------->AtMYB61 -----
                                             --------->YAB5                  <---------ALFIN1  <----
                                            <---------ATHB12      --------->MYB52(1)          ------
                                   --------->bZIP60(1)        --------->ANAC58              --------
                      <---------YAB1     --------->AtMYB61    --------->ANAC46             ---------
                  <---------MYB52(1)  --------->AtMYB61       --------->ANAC58         <---------At4g35610
                 <-------GAMYB     <---------bZIP60(1)     ----------->HVH21 <xxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
               <------NtERF2    ----------->HVH21        ------>NtERF2       <XXXXXXXXXXXXXXXXXXXXMIR834
          --------->HSFB2a(1) --------->At4g35610        --------->At4g35610 <xxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
          <---------HSFB2a(1) <---------At4g35610        <---------At4g35610 <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
----YAB1---------->DOF2--------->YAB5--------->MYB46(3)<---------RAP2.6(2)  --------->MYB46(3)------
 
atacaaaaatagaaagtccccgttgatgactgcttctgacaccaccaatgcttccattgccgctcacgctatcggcattaccaccgctactgctaccaac  2641500
       <---------ZAT2
       --------->ZAT2
----------HVH21
--->MYC3                                                                --------->MYB52(1)
----MYC3                                                              <------NtERF2
>>>>>>BZIP12                                                          <---------At4g35610
>>>>>>ABI5                            ------->TEIL                    --------->At4g35610
-----TGA1a              <---------ARR11(2)                            <---------ZAT2
---->TGA1a              --------->ARR14(2)     <---------YAB1      <------NtERF2         <---------ANAC58
---->O2<---------At4g35610       <---------ANAC58      <---------RAP2.6(3)               <---------ANAC58
-----O2--------->At4g35610       <---------ANAC58      --------->At5g28300  --------->At5g28300
>MYB83 ----------->RAV1(2)       <---------AtLEC2     --------->RAP2.6(2)  ----------->GT1      ----
->AtMYB61               --------->ARR11(2) <---------ANAC58    <---------MYB46(3)   <------ZmHOX2a(1)
>MYB46(3)               <---------ARR14(2) <---------ANAC58   <---------AtMYB61    --------->DOF5.7(1)
>MYB46(1)          <---------At5g28300<---------AHL12(2)      --------->ALFIN1  --------->DOF5.7(1)<
 
gtgtcataccagctgctactatcaccgtttccacttgcatgaattttcttgtgatggccgtaatagtggtggcagcaacggttaaaaggatggcttaaca  2641600
                   <---------RVE1(2)
               ----------->GT1                                                                   ---
               <---------MYB46(3)          --------->YAB1                                     <-----
              <---------AtMYB61            --------->ATHB12                         <---------------AtSPL3
              <---------DEAR3(1)          <---------YAB1                            --------------->AtSPL3
              --------->ALFIN1         --------->DOF5.7(1)                *TSS<---------TOE2(3)<----
    <---------At4g35610               <---------AHL20(3)                  <------------CBF    ------
    --------->At4g35610     <-----------HVH21                            <---------AHL20(2) ------->TEIL
   XXXXXXXXXXXXXXXXXXXX>MIR834 --------->At4g35610                       --------->ATHB12--------->ANAC58
 <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)   --------->AHL20(2)                <---------YAB5   --------->ANAC58
----->KAN1 --------->ALFIN1<-----------RAV1(1)                  <-----------RAV1(1) <---------------AtSPL8
-------TEIL<---------DEAR3(1)  <---------At4g35610     ----------->GT1  --------->ICU4  ------------
 
tgttcgtagcagaagcggtggtgattttggctgtcgctgaaaaaaatgatagcacaactggtaacatatgttgtatttattgaggtagaagtacgaacct  2641700
         --------->YAB1
       --------->RVE1(2)
    ------------>CBF                                                                               <
  ------>ZmHOX2a(1)                                        --------->ANAC58                        -
------>KAN1                                                --------->ANAC58                     ----
----DOF5.7(1)                                        <------------CBF         ----------->RAV1(1) <-
------DOF2          --------->ZAT6           --------->TOE2(3)     <-----------------AG--------->ANAC58
--->TOE2(3)   ----------->GT1                --------->TOE1(3)     <---------YAB5      --------->ANAC58
--->AtSPL8  ---------->DOF2        <-----------GT1------------>CBF <-----------------AGL3      <----
 
ttatcctcacaatcagaaagttaagactaagcgttgttttacatttagccttaaacaattgaacgaaatagacatttttggcaacatggaacgatacagt  2641800
     <---------WOX13(2)
     --------->WOX13(2)                ----------->GT1               --------->ANAC58
----------->GT1                       <---------TOE2(3)              --------->ANAC58
---------HSFB2a(2)       --------->TOE2(2)               <---------WOX13(2)
-------->HSFB2a(2)  --------->AHL20(3)<---------YAB1     --------->WOX13(2)                      <--
----->GLK1(2)       <---------AHL20(3)<---------TOE1(3)<---------AHL20(2)                     <-----
--------ANAC46 <---------YAB1 --------->DOF5.7(2)      --------->AHL20(2)                 <---------
-----GLK1(2) --------->KAN1  --------->YAB5         <----------DOF2---------->DOF2     <-----------GT1
 
ttctggtaaattacatttatgcttataatctacgtttacttatggttataatctacttttaattcatgtagaaagcactagttactgaaatcactttcta  2641900
                   ------>ZmHOX2a(2)
                 <---------ARR11(2)
                 <---------RVE1(2)
      --------->AHL12(1)             <---------ARR14(2)                              --------->TOE1(2)
      --------->KAN1<---------DEAR3(2)                                               --------->TOE2(2)
      <---------AHL12(1)             --------->ARR14(2)                             <---------KAN1
     --------->ARR11(3)           <---------AHL20(3)                                --------->KAN1
     --------->AHL12(1)           --------->AHL20(3)                            --------->LBD16
     <---------AHL12(1)           --------->AHL20(2)                           --------->HSFB2a(2)
     <---------AHL20(1)           <---------AHL20(2)                           <---------HSFB2a(2)
     --------->AHL20(1)         <---------AHL12(2)                       --------->AHL20(2)
     --------->AHL20(3)        --------->YAB1                            <---------AHL20(2)
     <---------AHL20(3)      <---------YAB1                              <---------AHL25(3)
     <---------AHL25(2)<-------TEIL<---------AHL12(2)                    <---------AHL25(1)
     --------->AHL25(2)<---------ZAT14        <-----------GT1            --------->AHL25(1)
    --------->AHL12(2) <---------ZAT18   ----------->GT1                 --------->AHL12(3)       --
--------DOF2     --------->GATA12 --------->YAB1                        --------->AHL25(3)        <-
------GT1        <---------GATA12 <---------AHL25(3)                    --------->AHL20(2)        <-
-DOF2<---------ARR11(3)--------->ZAT14<-----------GT1      <----------DOF2    <---------LBD16     --
 
ctttctaaaatattctattagatcggttcactattaataatatacggtttaaccagtttgggctcttcgttgctatttatttcccgaacatacgatttta  2642000
              --------->TOE2(3)
        --------->ATHB12
        <---------ICU4
       --------->ICU4
       <---------YAB1
 <---------AHL12(2)
<---------AHL12(2)
--------->AHL12(3)                  <---------RVE1(2)
<---------AHL12(3)                  <---------GLK1(2)
--------->AHL20(2)           <---------YAB5                                                     <---
--------->AHL25(2)       --------->ANAC46                                           <---------AHL20(2)
------->AHL20(3)    --------->RVE1(2)                                        <-------TEIL    -------
--------AHL20(2)    --------->ARR11(2)                                --------->WOX13(2)     <------
--------AHL20(3)    <---------ARR14(2)      ------>ZmHOX2a(2)         <---------WOX13(2) <----------
------->AHL20(2)    --------->ARR14(2)    --------->GATA12          <---------YAB1  --------->AHL25(3)
 
aaaaaatatacttattgccttaatatccactaaacatctgattctgatctataagttttcaatcttccattttcattaggctcatgttttattttcagct  2642100
                                                              --------->ARR14(2)
                                                              <---------ARR14(2)
                                                              <---------ARR11(2)          <---------ALFIN1
                                                             <---------KAN1            --------->ANAC46
                                                  <---------ANAC55(2)             --------->ARR14(2)
  <---------DAG2                                  ----------->GT1                 <---------ARR14(2)
  <----------DOF2     <-----------GT1          --------->DOF5.7(1)                ------->TEIL
------WRKY38(1)<------ZmHOX2a(2)             <---------AHL12(2)   --------->YAB5  --------->GATA12
-->At4g35610  --------->ARR11(3)     <----------ID1--------->TOE2(3)              <---------GATA12
---At4g35610  <---------ARR11(3)     ----------->GT1      --------->YAB5     ----------->GT1<-------
-GT1          --------->RVE1(2)    --------->MYB52(1)---------->DOF2    <---------------AGL15
 
caacgcttttcattcaagatcattttaaccaaaaaacaaaacgaaaaaaaaaaacgtaaaacgagtatatgtttactaaatggtgaatcttcgacacact  2642200
<- Previous    Next ->

AGI:  At5g08210.1   
Description:  MIR834a; miRNA
Range:  from: 2641427    to: 2641675    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version