AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                      <---------ANAC46
                                    --------->ARR14(2)
                                    --------->ARR11(2)
                                ------>ZmHOX2a(2)
                               <------ZmHOX2a(2)
                               <---------KAN1
      --------->ANAC55(2)     --------->GATA12
      <---------ANAC55(2)     --------->ARR11(2)                             <----------DOF2
   <---------MYB52(1)         <---------ARR14(2)    --------->YAB1       ----------------->AGL1
   --------->ARR11(2)         <---------GATA12      <---------ICU4       <-----------------AGL1
   <---------ARR11(2)         <---------ARR11(2)    --------->YAB5 <---------GATA12
  <-----------HVH21           <---------RVE1(2)    <---------YAB5  <---------ARR14(2)
-----ZmHOX2a(2)               <---------AGP1       <---------ATHB12--------->GATA12
-------ARR11(2)               --------->ARR14(2)   --------->ICU4  --------->ARR14(2)
-------GATA12                <---------ARR14(1)    <---------YAB1  --------->RVE1(2)
------>ARR11(2)          --------->GATA12--------->DEAR3(1)   <-----------------AGL1
------>GATA12            <---------GATA12<---------DEAR3(1)  --------->RVE1(2)                 -----
-->RVE1(2)<---------ARR11(3) <---------CCA1(2)  <---------KAN1----------------->AGL1      ----------
 
gatcccgttacgagatacttcatattcaaatcggatctgtatcgtcgacgagtaatcataacaatacccaaatcggaccgatttagggcaaacgagttat  1861300
                                                                         ----------->GT1
                                                                         ------>ZmHOX2a(2)
                                  <---------ARR11(2)                    --------------->AtSPL8
                                  <---------ARR14(2)                    --------------->AtSPL3
                                  --------->GATA12                      <------ZmHOX2a(2)
                                  <---------GATA12                     <---------ARR11(2)
                           <---------ARR14(2)                          <---------ARR14(2)
                           --------->GATA12                            --------->ARR14(2)
                           <---------GATA12                            --------->ARR11(2)
                         --------->LBD16                               --------->GATA12
                       <---------LBD16             --------->ANAC58------->MYC3                 ----
                    ------>MYB83  <---------RVE1(2)--------->ANAC58<-------MYC3                 ----
                    ------>MYB46(1) <---------DEAR3(1)     <---------GLK1(1)                  ------
                  --------->AtMYB61 ------>ZmHOX2a(2)     --------->ARR11(3)                --------
                  <---------MYB59 --------->ARR11(2)      <---------ARR11(3)                --------
                >>>>>>>>>>MYB80   --------->ARR14(2)    --------->ICU4 <---------GATA12 --------->ANAC46
---->KAN1   <---------KAN1 --------->ARR14(2)     --------->DAG2   <---------LBD16      --------->YAB1
->GT1      --------->RVE1(2)<---------KAN1       ---------->DOF2  --------->ANAC46--------->RVE1(2)
 
attcaagttaaacgaatcaaaccaaacccggattttagatcggcgtaatccaaaaagcaaagatttcacacgcggatcgtacatatatcaaacacaaccc  1861400
     --------->RVE1(2)                                                <-------TEIL
   <---------AHL12(1)                                   --------->AHL25(3)
   --------->AHL12(1)                       --------->YAB1<---------WOX13(2)
  --------->AHL20(2)                        --------->YAB5--------->WOX13(2)
  --------->AHL20(3)                   <------ZmHOX2a(2)--------->AHL25(1)
----->ANAC58                          <---------ARR11(3)--------->AHL20(2)                        --
----->ANAC58                          --------->GATA12  <---------AHL25(1)                        --
->GAMYB                         --------->MYB52(1)      <---------AHL12(1)                        --
->ANAC58          ---------->DOF2     <---------GATA12  --------->AHL12(1)                  --------
->ANAC58  --------->GATA12--------->YAB1    --------->TOE2(3)   --------->GATA12      --------->YAB5
 
agcaaaaaaatcaaatcgattcaaagaaatcaaaacaacgagatcaacgataacccagattaattcaaatcgattcatagaattaagaacgacgatatca  1861500
                                               <-------TEIL       <---------YAB1    <---------YAB1
                                             <---------MYB52(1)<------NtERF2       <---------GLK1(2)
                                           <---------------AtSPL3 --------->ICU4  <--------ATHB1
                                    <---------ANAC58      --------->O2            --------->YAB5
                                    <---------ANAC46      <---------TGA1a         --------->KAN1
                                    <-----------------AGL1<---------O2            --------->YAB1
------->YAB5             --------->MYB46(3)<---------TOE1(3)---------->ID1       --------->ICU4
------->TOE2(3)          <---------KAN1   <-----------RAV1(2) ------>NtERF2      <---------ATHB12
------->YAB1 --------->DOF5.7(1)    <---------ANAC58      --------->TGA1a        <---------YAB5
->RVE1(2)  ---------->DOF2       ----------->HVH21<---------MYB52(1)  ------>ZmHOX2a(2) <-----------GT1
 
acgataaacccattaaaagacgcgaagaacaaacctctgacttgttcaggtacgtttgctctcgtcgccatgatcgctctcccaatgattcttactcttc  1861600
                                                                                            --------
                                                                                          --------->MYB46(3)
                                                                                          --------->DEAR3(2)
                                                                                       <------ZmHOX2a(1)
                           ---------->DOF2                                          <------ZmHOX2a(1)
                        <---------ANAC46             <------------CBF             --------->ALFIN1
                     <----------DOF2                --------->ATHB12         --------->DOF5.7(1)
                    <---------DOF5.7(1)      ----------->TGA1         <---------ANAC46 --------->ATERF1(1)
                <-----------GT1            <---------KAN1         <---------At4g35610--------->ALFIN1
            <---------RVE1(2)--------->DOF5.7(1) *TSS<---------GATA12<---------At4g35610  --------->ATERF1(1)
            <---------ARR11(3) <---------GLK1(2)<---------ANAC46--------->ZAT18  <------ZmHOX2a(1)--
 
ttgtttcttagtcttgatatttctctttcgtaaagagtctctgcgattgtgacgaagattggaagcgagcgctgcttatgaagaggaggaggagccaacg  1861700
                                                            <---------RVE1(2)
                                                            <---------GATA12
                                                    --------->AHL12(2)
                                                   --------->AHL25(3)
                                                   --------->AHL20(2)
                                                   --------->AHL25(2)
                                                   <---------AHL25(2)
                                                   <---------AHL25(3)
                                                   <---------AHL25(1)
                                                   --------->AHL25(1)
                                                   <---------AHL20(2)
                                                   --------->AHL20(3)
                                                  <---------AHL20(2)
                                                  <---------AHL25(1)
                                                  --------->AHL25(1)    <---------RVE1(2)
                                               ----------->GT1          <---------ARR11(2)
                                               --------->ATHB12 --------->MYB52(1)
                                               --------->YAB5 ------>ZmHOX2a(2)
                                              <---------YAB1--------->GATA12
                                        <-------GAMYB       --------->RVE1(2)<--------P
                                        <-----------HVH21   <---------ARR11(3)
                                  --------->At4g35610       --------->ARR11(3)
                                 <---------MYB46(3)<---------AHL20(3)   --------->ARR14(2)
                                 <-----------RAV1(1)<---------AHL12(2)  <---------ARR14(2)
                               ----------->RAV1(2)--------->AHL20(2)    --------->ARR11(2)
         ------->GAMYB    --------->GLK1(1) <---------At4g35610----------->HVH21
        --------->MYB46(3)<---------GLK1(1)--------->MYB52(2)<------ZmHOX2a(2)
      --------->MYB52(1) <---------GATA12<---------MYB52(1) <---------AGP1 <------MYB46(1)
->MYB52(1)<-----------HVH21    <---------At4g35610--------->AHL25(3)  <---------MYB46(3)           -
---------->CBF       <---------LBD16    <---------RAP2.6(3) --------->AGP1 <------MYB83          ---
 
gttcaattccaacggtcatatttttggggatttcatctgttgccgttagatgattaaattttagatctaacggtggataggttagtcttcgaagttggaa  1861800
                                                                                                ----
                                                                                                ----
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                                <---
                                                                                             -------
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                            ----------->GT1                  <------
              <---------AHL12(2)                           --------->DAG2                    <------
             --------->AHL12(2)                           --------->DOF5.7(1)                -------
             <---------AHL12(2)                       <---------AHL25(3)                     <------
             --------->AHL20(3)                       --------->AHL20(2)                    --------
             --------->AHL25(2)                      <---------------AGL15                  --------
             <---------AHL20(3)                      --------->AHL20(2)                     <-------
   <------NtERF2                                --------->At5g28300                       <---------WOX13(2)
  ------>NtERF2  <-----------GT1         <---------MYB52(1)--------->DOF5.7(1)            --------->WOX13(2)
 <---------ATERF1(2)                    <-------GAMYB===============================================
 --------->ATERF1(2)     <---------YAB5<---------MYB46(3)---------->DOF2              --------->TOE2(3)
-------->At4g35610 --------->ZAT6    ------>NtERF2  <---------WOX13(2)          --------->AHL25(3)
------>ZAT18--------->AHL12(1)   <---------KAN1----------->GT1 ---------->DOF2<----------DOF2-------
 
tgcgctggcactggataattttacactagtcatcgaatgaggccgttggactgtaaataaaaaaggtaaagcccatcccaacttttatttcttaattaaa  1861900
        --------->YAB5
     <---------KAN1                                                                    <---------AHL12(3)
----->AHL20(3)                                                                         <---------AHL25(2)
----->AHL12(1)                                                                         <---------AHL25(3)
------AHL12(1)                                                                         --------->AHL25(2)
------AHL25(2)                                                                         <---------AHL20(2)
----->AHL25(2)                                                                         --------->AHL25(1)
------AHL20(3)                                                                         <---------AHL25(1)
-->AHL25(1)                                                                            --------->AHL12(3)
-->AHL25(2)                     <---------YAB1                                        <---------AHL20(1)
---AHL25(2)                  <---------YAB5                                           --------->AHL20(1)
---AHL25(3)                  <---------YAB1                                           <---------AHL25(2)
---AHL25(1)               <---------AHL20(2)                                          --------->AHL25(2)
---AHL12(3)           --------->AHL12(1)                                              <---------AHL25(1)
-->AHL20(2)           <---------AHL12(1)                                              --------->AHL25(3)
---AHL20(2)       ----------->GT1                                                     --------->AHL25(1)
->YAB1 <---------YAB1 <---------KAN1  ----------------->AG                            --------->AHL20(2)
->AHL20(2)     ---------->DOF2<---------ICU4                       <---------TOE2(3)  <---------AHL20(2)
--AHL20(2)   <---------TOE2(3)--------->KAN1                       --------->MYB59    <---------AHL12(3)
========================================================MADS_MADS  <---------TOE1(3)  --------->AHL12(3)
-->AHL12(3)  <---------YAB1  --------->ICU4  ----------->GT1   --------->YAB5         <---------AHL25(3)
 
attttggaatatgattaagaaaggaatatttcattattctttccaaaatagcaaaatgagattgtatgtttaggttttttgaaaacaaataaaatttgaa  1862000
                                                                                      --------->AHL12(3)
                                                                             <---------AHL20(2)
                                                                             <---------YAB1
                                                                            --------->AHL20(1)
                                                                            --------->AHL25(1)
                                                                            --------->AHL20(3)
                                                                           --------->YAB1
                                                                         <---------AHL12(3)
                                                                         --------->AHL12(3)
                                                                         <---------AHL12(2)
                                                                        <---------AHL25(3)
                                                                       <---------AHL20(2)
                                                                       --------->AHL20(2)
                                                                       --------->AHL12(1)
                                                                       --------->AHL12(3)
                                                                       <---------AHL12(1)
                                                                       <---------AHL20(3)
                                                                       <---------AHL25(1)
                                                                       <---------AHL12(3)
                                                                       --------->AHL25(3)
                                                                       --------->AHL20(3)
                                                                       --------->AHL25(1)  ---------
                                                                      --------->AHL12(2)<---------AHL12(2)
                                                                  --------->TOE2(3)   <---------AHL20(3)
                                                                 ----------->GT1      --------->AHL20(2)
                                                               <---------ARR11(3)     --------->AHL25(2)
                                                              --------->CCA1(1)       --------->AHL25(1)
                                                              --------->RVE1(1)       --------->AHL20(3)
                                                            <---------AHL12(3)        <---------AHL12(3)
                                                            --------->AHL12(3)   --------->YAB1
                                   --------->RVE1(2)        --------->AHL12(2)   --------->AHL20(2)
                                   --------->ARR11(3)       <---------AHL12(2)--------->YAB1 <------
                 --------->RVE1(2) <---------ARR11(3)     --------->AHL20(2)--------->AHL20(2)
                <---------CCA1(2) --------->RVE1(1)       --------->AHL12(3)<---------AHL20(1)
     --------->ARR14(2)           --------->CCA1(1)       --------->AHL20(3)<---------AHL20(3)
     --------->ARR11(2)           <---------KAN1          <---------AHL20(3)<---------AHL25(3)
     <---------ARR14(2)       --------->AHL20(2)          --------->AHL25(1)--------->AHL25(3)
     <---------ARR11(2)     --------->RVE1(2)             <---------AHL12(3)<---------AHL25(2)
  <---------ANAC46  ----------->HVH21                     --------->AHL25(2)--------->AHL25(2)
 
agtcttcgtatatggacatatatctgaccaaaatcaaatatctgtgtatttttcaaaaaaaaaaaatatcgtaaataaatataataaaaaaaaataaagg  1862100
                       --------->AHL25(2)
                       --------->AHL12(1)
                       <---------AHL12(3)
                       <---------AHL12(1)
                       <---------AHL25(2)                                   <---------YAB1
                       <---------AHL12(2)                                  <---------AHL20(3)
                       <---------AHL25(3)                                  <---------AHL12(3)
                      --------->AHL25(3)                                   --------->AHL12(3)
                      <---------AHL25(3)                                   --------->AHL20(2)
                      <---------AHL25(2)                                <---------AHL20(3)
                      --------->AHL25(2)                                <---------AHL25(2)
                      <---------AHL20(1)                                --------->AHL20(3)
                      --------->AHL12(1)                                --------->AHL25(2)
                      --------->AHL20(2)                                --------->AHL12(2)
                      <---------AHL20(2)                                <---------AHL12(2)
                      <---------AHL12(1)               --------->ARR14(2)  --------->AHL20(3)
                      <---------AHL25(1)               --------->ARR11(2)  --------->AHL25(2)
                      --------->AHL25(1)               <---------ARR11(2) <---------ICU4
                --------->TOE2(3)                      ------->TEIL    --------->AHL12(1)
                <----------DOF2                        <---------ARR14(2)--------->ICU4
           <---------ANAC58                           <---------CCA1(2)<---------AHL12(1)
           <---------ANAC58                     <---------TOE2(3)    <---------RVE1(2)
     ----------->HVH21--------->AHL12(3)        <---------TOE1(3)   --------->YAB1
->DOF2    --------->At4g35610             <---------RVE1(2)        <---------YAB1
---TOE2(3)<---------At4g35610           <---------TOE2(3)     <---------AHL20(2)---------->DOF2
 
taaactatgtgatagcttactttaaaaaatttgacagtcgtatgaggtattgaggttgtatctgtttattttgataatttttataaagtttgactcaaat  1862200
<- Previous    Next ->

AGI:  At5g06150.1   
Description:  CYC1BAT (CYCLIN B 1;2); cyclin-dependent protein kinase regulator. Identical to Cyclin-B1-2 (CYCB1-2) [Arabidopsis Thaliana] (GB:Q39067;GB:Q9FG02); similar to CYCB1,3 (CYCLIN B1,3), cyclin-dependent protein kinase regulator [Arabidopsis thaliana] (TAIR:AT3G11520.1); similar to mitotic cyclin [Sesbania rostrata] (GB:CAA99990.1); contains InterPro domain Cyclin (InterPro:IPR006670); contains InterPro domain Cyclin, A/B/D/E (InterPro:IPR014400); contains InterPro domain Cyclin, N-terminal (InterPro:IPR006671); contains InterPro domain Cyclin-like (InterPro:IPR011028); contains InterPro domain Cyclin, C-terminal; (InterPro:IPR004367)
Range:  from: 1859280    to: 1861650    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version