AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
       ----------->GT1
      <---------TOE2(3)                                                              --------->DOF5.7(1)
    ---------->DOF2                                                                ---------->DOF2
----------GT1                                                                      --------->DOF5.7(1)
----->HSFC1(2)                                                               <------NtERF2
------KAN1                                         <---------DEAR3(1)       --------->LBD16
----->HSFB2a(1)                                  ------>NtERF2             <---------ANAC46
------HSFC1(2)                                  ----------->HVH21         <------NtERF2    <------ZmHOX2a(1)
------HSFB2a(1) --------->TOE2(3)               --------->DEAR3(1)        --------->ATERF1(1)
-------ARR10    <----------DOF2                --------->DEAR3(2)       <---------DEAR3(1) =========
-----KAN4(2)    --------->TOE1(3)     ------->TEIL<------NtERF2<---------YAB1----------->GT1
 
ttttccctaaaggtttaaactttaacaattgaattttgacggacctcgttgccgacggtgatgagcatgattttggaggcgggataaaaaggaaggacat  16483600
                                  <------NtERF2
                             ------>ZmHOX2a(2)                                 -------->P
                           --------->GATA12                            <---------YAB1
                           --------->ARR14(2)                     <---------At4g35610
                           <---------ARR14(2)                     --------->At4g35610     ------>NtERF2
                           <---------ARR11(2)                  ------>NtERF2   ------>MYB46(1)
                           <---------GATA12                   --------->DEAR3(1)          --------->LBD16
                      <---------MYB52(1)                     <---------ABI4(2) ------>MYB83
                   <------NtERF2 --------->ANAC58         --------->At4g35610--------->DEAR3(1)
                  <---------RAP2.3(1)                     <---------At4g35610--------->MYB46(3)
                 <---------RAP2.6(2)                   --------->DOF5.7(2)  --------->DEAR3(2)------
                 <---------DEAR3(1)                    <---------MYB52(1)<---------ARR14(2)------>NtERF2
                --------->At4g35610                   <-------GAMYB  --------->YAB5      <---------RAP2.6(2)
               --------->MYB52(1)--------->ANAC58   <------NtERF2--------->DEAR3(1)     <---------LBD16
      ------>ZmHOX2a(2)    --------->ARR11(2)      ------>NtERF2<------NtERF2<---------MYB46(2)    <
      ===========================HOX2a_HOX2a      --------->DEAR3(1)----------->TGA1  <---------ARR11(2)
    --------->GATA12<---------ANAC46              <---------DEAR3(1)----------->HVH21 --------->ARR11(2)
=============HOX2a_HOX2a  <------ZmHOX2a(1)    <---------KAN1--------->At4g35610  ----------->RAV1(2)
 
tggagttgatccattgagtagcggcgttaggatcggaggcaagagaaggaacgtcgccgttagcagcgccgatgacgataccgacccctgttccggccaa  16483700
                       --------->At5g28300
                      --------->RAP2.3(2)
                      --------->RAP2.3(3)
                      <---------ANAC46
                     <------NtERF2
                     --------->RAP2.3(1)
                     --------->RRTF1(1)
                    <---------ATERF1(1)
                    <---------RAP2.3(1)
                    ------>NtERF2
                   --------->DEAR3(1)
                  --------->RAP2.3(1)
                 <---------ATERF1(1)
                 <---------RAP2.3(1)
                ------>ZmHOX2a(2)
              --------->GATA12
              <---------ARR14(2)                                                                 ---
              <---------ARR11(2)                                                               <----
              <---------GATA12                                                                 <----
              --------->ARR14(2)                                 ------------>AtMYB77         <-----
            <------NtERF2---------->DOF2                         --------->MYB52(1)           <-----
           --------->LBD16         <----------DOF2               <---------WRKY18(1)          <-----
          <---------ANAC58        --------->HSFC1(2)            ----------->HVH21             <-----
          <---------ANAC58        <---------HSFC1(2)<---------ANAC46                          <-----
          <---------ANAC46--------->DAG2            <---------GATA12                     <---------RVE1(2)
     <---------ICU4<---------DEAR3(1)               <---------ARR11(2)            <------NtERF2<----
    <---------YAB1--------->ATERF1(1)     <---------WOX13(2)   <----------DOF2  <---------DEAR3(1)--
  --------->YAB1<---------DEAR3(1)--------->HSFB2a(1)         <---------ANAC58  --------->ALFIN1----
---->DOF2<---------LBD16<---------MYB52(1)--------->WOX13(2)  <---------ANAC58 <---------LBD16------
----------DOF2--------->ARR11(2)  <---------HSFB2a(1)      <------ZmHOX2a(1) --------->DOF5.7(1)<---
 
agctttgatgatggcgggatcggcgccgtaaagtcgaactttctgaattgaagtggattggaggagcttgacggtttctgaaggcggagggagattgtcg  16483800
<---------bZIP60(2)
--------->O2
<---------O2
------>DEAR3(1)
-----ERF1
-----RAP2.3(1)
----DEAR4(1)                              --------->At5g28300                --------->At4g35610
----At1g77200                            ----------->GT1                ----------->GT1
----RAP2.3(3)                            <---------DEAR3(2)            --------->DAG2
----DEAR3(1)                            <---------At1g77200            --------->DOF5.7(1)
----DREB2C(2)                        <-----------RAV1(1)               <---------TOE2(3)         <--
-----ATERF1(1)                     <---------At4g35610                --------->DOF5.7(1)        ---
---->NtERF2                        --------->At4g35610            <------ZmHOX2a(1)    --------->DOF5.7(1)
----->ATERF1(1)    --------->At4g35610  --------->ETT(1)        ----------->GT1      ---------->DOF2
--->ETT(1)--------->WOX13(2)      --------->GATA12        <------ZmHOX2a(1)  <---------At4g35610 ---
---NtERF2 <---------WOX13(2)      ------->TEIL     --------->MYB52(1)--------->DOF5.7(1)         <--
 
gcgacttggccgtagttaactccgatgaaaggctctgcatctgtcggtaacaaaaaacagaggaagagaggaaaaaggttagatgaagaaaagaagaacg  16483900
                          <---------ANAC46
                          <---------ANAC58
                          <---------ANAC55(2)
                          <---------ANAC55(1)
                          <---------ANAC58
                          --------->ANAC55(2)
                          --------->TGA1a
                          <---------TGA1a
                          <---------O2
                         <<<<<<<<<NAP
                   <---------ARR14(2)
                   <---------ARR11(2)
                   --------->ARR11(3)                        <------ZmHOX2a(1)
-------O2 <---------ARR14(2)    <------ZmHOX2a(1)         <------ZmHOX2a(1)
------>O2<------ZmHOX2a(1)--------->O2              <---------At4g35610
------>bZIP60(1)   --------->ARR14(2)               --------->At4g35610                           *TSS
-------bZIP60(1)   <---------ARR11(3)            <------ZmHOX2a(1)      <---------RVE1(2)--------->YAB1
 
acgtcgtagtgaggaactagaagatacttacgtgaggatgggaagtgagagaggaagatgaggaggaaatagatggagatggagagagccattgatggtg  16484000
                                                                                           ---------
                                                                                           ---------
                                                                                           ---------
                                                                                           <--------
                                                                                           ---------
                                                                                           ---------
                                        <---------WOX13(2)                                 ---------
                          <---------MYB46(3)                        --------->At5g28300    <--------
                       <---------MYB46(3)<---------------AGL15    ==================================
                    <-----------RAV1(1) --------->ANAC55(2)       <------------MYB.PH3(1)  ---------
                <------------CBF        <---------ANAC55(2)     --------->MYB52(1)         <--------
              <------ZmHOX2a(1)    <---------MYB46(3)        <---------ZAT6         ================
            <---------TOE2(3)    <-------GAMYB             <---------At5g28300      ================
         --------->CCA1(2)<---------REM1(1)---------->DOF2<-----------GT1       --------->RVE1(2)
        <---------GATA12  <-----------RAV1(1)   --------->DOF5.7(1)----------->GT1  ---------->DOF2
 
agagagagagagatttaggaattgtgttgttgttgctgttgttacttaaagaagaggttttttactgtaacggttatatacaaactccaaagacacgtct  16484100
                        --------->WRKY38(1)
                     --------->ALFIN1
                    ------->MYC2
                    ------->MYC3
                    <-------MYC2
                    <-------MYC4
                    <-------MYC3
<---------ANAC58    ------->MYC4
<---------ANAC58   --------->ANAC55(2)
>ANAC55(2)         <---------TGA1a
>ANAC58            --------->TGA1a
>ANAC58            --------->O2                                                                  <--
-ANAC55(2)         <---------ANAC55(2)                                                       <------
>ANAC55(1)         <---------O2                                                   <---------AHL20(2)
>bZIP60(2)      --------->ZAT14                                                  <---------AHL20(3)
>O2             <---------ZAT14                                                  --------->AHL20(2)
-O2             <---------REM1(2)                                                <---------AHL20(2)
=MYC_MYB      --------->ANAC46                                             ----------->GT1 <--------
>TGA1a      --------->ANAC46                                 <---------ARR11(2)  --------->AHL20(3)
-TGA1a <-----------GT1--------->REM1(2)                      --------->ARR11(2) --------->AHL12(2)
=bZIP_DOF   --------->ZAT6                     <---------At4g35610  <----------DOF2  <-----------GT1
=============================bZIP_DOF          --------->At4g35610 <---------DOF5.7(1)  <----------DOF2
 
tgtgcttgtttttccacactacacgtgttgacttctgttcacaagtcttgagcttaagtcttcgtttcggtctttattttgtaattttatacttttgatt  16484200
                                                 <----------DOF2
                                                --------->YAB5
                                              <---------ARR11(3)
                                              --------->ARR11(3)
                                             <---------GLK1(1)
          <---------WOX13(2)        <---------HSFB2a(2)
      <---------At4g35610           --------->HSFB2a(2)
   <---------YAB5                  <---------LBD16
  <-----------TGA1            <---------------AGL15       --------->RVE1(2)
  <-----------HVH21     --------->DAG2       --------->GLK1(1)   --------->DOF5.7(1)
---------GT1           ---------->DOF2     <------ZmHOX2a(1)   ---------->DOF2             <--------
---RVE1(2)--------->WOX13(2) <-----------------AGL2       --------->GLK1(2)               <---------ANAC58
-YAB1 <-----------------AGL1 <-----------------AGL3   <------ZmHOX2a(1)                   <---------ANAC58
 
tttctcgtcatctaatttggaaactgaaaagtgctatttctggagaggaaatctttaggagaatcgaaaagagagcatttgttttttgagtttgcttttg  16484300
                   --------->YAB5                                      --------->ARR11(2)
                   --------->ATHB12                                    <---------ARR11(2)
                  --------->ICU4                                    --------->MYB52(2)
                  <---------YAB1                                <---------MYB46(3)
                <------ZmHOX2a(1)                        --------->ANAC46
     <---------RVE1(2)                                   <-----------GT1    --------->AtLEC2
--DOF2--------->KAN1 <---------YAB1              ----------->GT1--------->KAN1
 
aagcatgaggtattccataggatgattagtatcgcaaaacacatatttcagtgtgtaaatacaccatttgttcgtttccatgctatttctcagtagtcca  16484400
                                    <---------AHL25(2)
                                    <---------AHL12(2)
                                    <---------AHL12(3)
                                    --------->AHL20(3)
                                    <---------AHL20(3)
                                    --------->AHL25(2)
                                   --------->ATHB51
                                   <---------AHL20(1)
                                   <---------ICU4
                                   <---------AHL25(2)
                                   --------->AHL20(2)                           <---------YAB1
                                   --------->YAB1                            <---------YAB1
                                   <--------ATHB1                           --------->AHL20(3)
                                   <---------AHL12(1)                       --------->AHL25(2)
                                   --------->AHL12(1)                       <---------AHL20(3)
                                   --------->AHL25(2)                       <---------AHL25(2)
                                   <---------AHL25(3)                       <---------AHL12(2)
                                   --------->AHL25(1)                      --------->ATHB51
                                  --------->AHL25(3)                       <--------HAHB4
                                  --------->ICU4                           <---------ICU4
                                  <---------ATHB51                         -------->ATHB1
                                  <---------ATHB12                         --------->YAB1
                            --------->AtMYB61    <---------YAB5            --------->YAB5
                            ------->GAMYB      <---------ANAC58           <---------ATHB51
                           <---------MYB55(2)  <---------ANAC58           --------->ICU4       -----
                        --------->MYB46(3)     <---------ANAC46           --------->AHL25(3)   -----
           ---------->DOF2 --------->MYB46(3)  --------->ANAC55(2)        <---------YAB1       <----
   --------->KAN1     --------->ANAC46      <----------DOF2         ------->GAMYB          <--------
  <---------YAB5     --------->MYB46(3) <-----------GT1           --------->ANAC46 --------->WRKY38(1)
 
agttaaacattcttcaaagtttcacccacaaccaccaataattttagctttcgtgattccacaatgtacaactcacaattattatgttgactgtggtcac  16484500
<- Previous    Next ->

AGI:  At4g34480.1   
Description:  glycosyl hydrolase family 17 protein. Identical to Putative glucan endo-1,3-beta-glucosidase 7 precursor [Arabidopsis Thaliana] (GB:Q9M069;GB:O65675;GB:P80829); similar to glycosyl hydrolase family 17 protein [Arabidopsis thaliana] (TAIR:AT2G16230.1); similar to unknown [Populus trichocarpa] (GB:ABK95331.1); contains InterPro domain Glycoside hydrolase, family 17; (InterPro:IPR000490); contains InterPro domain Glycoside hydrolase, catalytic core; (InterPro:IPR013781)
Range:  from: 16481884    to: 16483999    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version