AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                   -
                                                                                             -------
                                                                                             -------
                                                           <---------YAB1  <---------HSFB2a(2)     -
--------------->AtSPL8     ------>ZmHOX2a(1)    ------->GAMYB              --------->HSFB2a(2)------
<---------------AtSPL8  <-----------GT1     <---------ALFIN1     <---------WOX13(2)          -------
-->ZmHOX2a(1)         --------->GLK1(1) <---------ZAT2     <---------TOE2(3)                 <------
-----MYB59           ------->TEIL       --------->ZAT2 --------->YAB1 --------->GATA12 <-------TEIL-
 
taatttgtactaacatttggaacgtatttcctactcttctccctgctccaactcccaaaaataagattagttagatttctataactaatatacatgtata  9758900
                                                             <---------DEAR3(1)
                                                            <---------MYB52(1)
                                             --------->AHL12(3)
       ----------->GT1   --------->DAG2      <---------AHL25(3)
<---------------AGL15   ---------->DOF2      <---------AHL12(3)           ----------->GT1
--------------->AGL15 <---------AHL12(2)     <---------AHL20(2)          <---------ANAC46
---------------->AGL3 --------->WOX13(2)     <---------AHL25(1)          ----------->GT1
-->ARR14(2)        --------->AHL20(3)        --------->AHL25(1)         <---------LBD16
-->ZAT14           --------->AHL20(2)       --------->AHL12(1)         --------->ALFIN1
---------------->AGL2 <---------WOX13(2)    <---------AHL12(1) <-------GAMYB       --------->DOF5.7(1)
--->KAN1--------->At5g28300                 --------->AHL25(3)<---------DEAR3(2)   <----------ID1
-->ARR11(2)        <---------AHL20(3)       --------->AHL20(2)<---------MYB46(3) --------->DOF5.7(1)
---ARR11(2) <-----------GT1    <---------WOX13(2)        --------->DEAR3(2)      ---------->DOF2----
---------------->AGL1--------->YAB1  <---------AtLEC2 ---------->DOF2 --------->ALFIN1  --------->MYB52(1)
 
ctcccaaaaacagtaaaaccatattaataaagctaattttgcatagatttatttcggtaaaccggcggttcaagttggggaaaaaaaagacaaacggtct  9759000
                                                                                      <---------WRKY18(1)
                                                                                     ----------->HVH21
                                                                            --------->TGA2(1)
                                                                            <---------TGA2(1)
                                                                       <---------ANAC55(1)
                                                                       --------->ANAC55(2)
                                                 --------->YAB1        <---------ANAC58  ------>NtERF2
                                                 --------->YAB5        <---------ANAC55(2)
                                                <---------ATHB12       <---------ANAC58 <---------RAP2.6(2)
                                               ------>MYB46(1)         <---------ANAC46--------->RAP2.6(3)
                                               ------>MYB83      <---------TOE1(2)   --------->WRKY12
                                              --------->WOX13(1) <---------TOE2(2) --------->TOE2(3)
                                       <---------O2           <---------ANAC46   <---------YAB1
      ---------->DOF2                  --------->O2        <---------ANAC58 <---------bZIP60(1)
   --------->AtLEC2                   <-----------------------TaNAC69(2) ----------->HVH21     =====
------>DOF2         ---------->DOF2  --------->CCA1(2)     <---------ANAC58 --------->bZIP60(1)<----
 
aaagtcatccaaagacaaaaaaccaaagacaagttgagagagacgagaccaatcacaacattgcttcgtagattgcgtgacatcatccttgacggctact  9759100
                                  --------->WOX13(2)
                                  <---------WOX13(2)
                                --------->AHL20(2)
                                <---------AHL25(1)
                           <-------PIF4
                           ------->PIF4
                           <-------MYC3
                           ------->MYC3
                           <-------MYC2
                           ------->MYC2
                           ------->MYC4
                           <-------MYC4
                           <-------PIF5
                           ------->PIF5     --------->TOE2(3)
                          --------->TGA1a  --------->HSFC1(2)
                          --------->O2     <---------HSFC1(2)
                          <---------O2     <---------HSFB2a(1)
                          <---------TGA1a ------->TEIL
                          --------->ANAC55(2)
                          <---------ANAC55(2)
                         ------->TEIL<-----------GT1
                         ------------>OsbHLH66                             --------->YAB1     ------
                      --------->ANAC58 --------->ANAC58             <---------MYB52(1)      <-------
                      --------->ANAC58 --------->ANAC58      <---------HSFB2a(1)            <-------
                   --------->DOF5.7(1) --------->ANAC46      <---------HSFC1(2)        <---------DOF5.7(1)
       <---------ANAC46 <------------OsbHLH66                --------->HSFB2a(1)       <---------DAG2
====================================bZIP_DOF--------->TOE1(3)--------->HSFC1(2)  <-----------GT1<---
------DOF2    ----------->GT1   <---------AHL20(2)      --------->YAB1  <----------DOF2<----------DOF2
 
ttcatttgtgtcttatttggataaaacgcacgtgtttaattcacgaaccttcatagcaataagaaatttccattactttcatattttcaactttttttat  9759200
                        <-----------GT1
                     <---------WOX13(2)
                     <---------AHL12(2)
                     --------->WOX13(2)
                    <---------AHL20(2)
                   --------->AHL20(2)
                   <---------AHL25(1)
                   --------->AHL25(3)
                  --------->AHL12(2)
                  <---------AHL25(2)
                  --------->AHL12(3)
                  --------->AHL25(3)
                  <---------AHL12(2)
                  --------->AHL25(2)
                  <---------AHL12(3)
                 --------->TOE2(3)
                 --------->AHL12(2)
                 <---------AHL12(2)
                <---------AHL12(1)
               <---------AHL12(1)                      <---------TOE1(2)
               <---------AHL20(1)                      --------->LBD16
               --------->AHL20(1)                  <-----------GT1
               <---------AHL20(2)               --------->AHL20(1)
               --------->AHL25(2)               <---------AHL25(2)                            ------
               --------->AHL25(3)               <---------ARR11(3)                            ------
               --------->AHL20(2)               --------->AHL20(3)              --------->GATA12
               --------->AHL12(1)               <---------AHL20(3)    <---------DOF5.7(1)     <-----
               <---------AHL25(2)               <---------AHL20(1)   <----------DOF2          <-----
--->WOX13(2)   <---------AHL20(3)               <---------AHL12(1)   <---------DOF5.7(1)     -------
--YAB1         --------->AHL20(3)          --------->AHL20(2)    ------->TEIL------------>CBF<------
--AHL20(2)    --------->AHL12(2)           ------------>CBF<-------TEIL     --------->TOE2(3)-------
--------GT1 --------->AHL20(2)  <----------DOF2 --------->AHL25(2)  <---------DOF5.7(1)    ---------
 
tacccattacatgcttaaaatattaattcacaagtctttgtcaaaattcaatattttccaggttcatgaaccctttttatctcaatctactctataatat  9759300
                                                                                                   <
                                                                                                  <-
                                                                                                  --
                                                                                                  --
                                                                                                  --
                                                                                                  --
                                                                                                  --
                                                                                                  <-
                                                                                                 ---
                                                                                                 <--
                                                                                                 <--
                                                                                                 ---
                                                                                                 ---
                                                                                                 ---
                                                                                                 <--
                                                                                                 <--
      <---------WOX13(2)                                                                        <---
    --------->AHL20(2)                                                                          ----
   ----------->TBP                                                           ----------->RAV1(1)<---
--->RVE1(2)                                                        --------->AtMYB61            ----
--->ARR11(3)                                           --------->TOE2(3)  ------>MYB83          ----
------ARR10                                         <---------GLK1(1)     ------>MYB46(1)       ----
----ARR11(3)                          --------->MYB52(1)           <---------MYB59              <---
-->RVE1(1)            <----------DOF2--------->ANAC46--------->GATA12------>MYB83              -----
---KAN1              <---------DOF5.7(1) ----------->HVH21    --------->ANAC58             ---------
-->CCA1(1)<----------ID1             <---------ALFIN1<---------GATA12------>MYB46(1)       ---------
>YAB1 --------->WOX13(2)            *TSS --------->LBD16      --------->ANAC58         --------->KAN1
 
ctccctataaattacaacaaaacctctttatttttcattcacaccggacattttgaaatctcaacaagaaccaaaccaaacaacaaaaaaacattcttaa  9759400
    <----------DOF2
  <---------YAB1
 <---------ARR11(3)
 --------->ARR11(3)
 <-----------GT1
--------->YAB1                     <---------GATA12
---------YAB5               --------->ARR14(2)
--------AHL20(3)            <---------ARR14(2)
------->AHL20(3)            <---------RVE1(2)
------->WOX13(2)            <---------GLK1(2)
------->AHL25(2)            --------->ARR11(2)
------->AHL12(2)            <---------GATA12
------->AHL12(3)            <---------ARR11(2)
--------AHL12(2)           <------NtERF2
----->HAHB4              <---------ANAC46
-------AHL25(3)         <------NtERF2                                                         <-----
------HAHB4             <---------LBD16                                                       ------
------>YAB5            <---------RAP2.3(1)                                                    <-----
------>YAB1            ------>NtERF2                                                          ------
------>ATHB51          <---------RRTF1(1)                                                     <-----
-------ICU4            <---------ERF1  --------->YAB5                                     ------>NtERF2
------ATHB1           <---------DREB2C(2)                                                 <---------At4g35610
------AHL12(1)        <---------RAP2.3(2)                                                <---------ARR11(2)
----->AHL12(1)        <---------RAP2.3(3)                                                <---------ARR14(2)
------YAB1            <---------RRTF1(2)                                           <---------ARR14(2)
----->AHL25(3)        <---------DEAR3(1)                          --------->bZIP60(1)    --------->ARR14(2)
----->AHL20(2)        <---------RAP2.6(2)          <---------ANAC58                --------->ARR14(2)
----->ICU4            <---------RRTF1(3)       <----------DOF2    <---------bZIP60(1)    --------->ARR11(2)
------ATHB51         --------->RAP2.6(3)  --------->KAN1          --------->ANAC46 <---------ARR11(2)
---->AHL12(2)      ----------->TGA1--------->GATA12<---------ANAC58------>NtERF2  <------ZmHOX2a(1)
>TOE2(3)           ----------->HVH21  <---------YAB1             <---------------------WRI1<------NtERF2
>YAB1     <---------MYB52(1)--------->GATA12<---------YAB1    --------->SPL7(1)<------ZmHOX2a(1)
 
taattatctttctgttatgtcgatgacggcggattctcaatctgattatgcttttcttgagtccatacgacgacacttactaggaggaatcggagccgat  9759500
                      <---------MYB52(1)
                      --------->ARR11(2)
                      <---------ARR11(2)
                      --------->ARR14(2)
                      <---------ARR14(2)
       --------->ETT(2)                      <---------WRKY12        --------->ANAC58         ------
       ----------->HVH21                   <-----------HVH21    --------->SPL7(1)             <-----
       <---------ETT(2)               <---------ARR14(2)      --------->ZAT14                 ------
----MYB52(1)         <-------GAMYB    --------->ARR11(2)      <---------SPL7(1)               ------
--->ARR14(2)        ----------->GT1   --------->ARR14(2)      <---------ZAT14                 <-----
----ARR11(2)        <------MYB46(1)   <-----------GT1        --------->ALFIN1    <----------DOF2
--->ARR11(2)        <------MYB83      <---------ARR11(2)   <------------------SPL14          <------
----ARR14(2)       --------->MYB59   ----------->HVH21---------->DOF2--------->ANAC58   --------->MYB52(1)
 
actcagtgagtcgacagcgagttcggttactcaatcttgtgtaaccggtcagagcattaaaccggtgtacggacgaaaccctagctttagcaaactgtat  9759600
                                                                                                 <--
                                                                                                 <--
                                                                <---------TOE2(3)    ----------->HVH21
                                                                --------->ANAC46    <-----------HVH21
                                                           --------->WOX13(2)      <----------DOF2
                                                          --------->MYB52(2)      <---------DOF5.7(1)
                         <---------At5g28300        --------->GLK1(1)           ------>NtERF2 <-----
                      --------->CCA1(2)             <---------KAN1  <---------ARR14(2)        <-----
                     --------->GATA12               --------->CCA1(2)          --------->ANAC58 <---
                     <---------ARR14(2)             <---------GLK1(1)       --------->MYB46(3)------
                     <---------GATA12              <---------ARR14(2)   ------>ZmHOX2a(1)    <------
  <----------DOF2    <---------RVE1(2)             <---------ARR11(2)  --------->TOE2(3)    <-------
 <---------ANAC58    --------->ARR14(2)            <---------RVE1(2)--------->ARR11(2)      --------
 <---------ANAC58  ----------->ARR10               --------->ARR11(2)  --------->ANAC46  -----------
--->ARR11(2)   <---------LBD16                     --------->ARR14(2)  --------->TOE1(3)--------->ANAC46
----ARR14(2)  --------->ALFIN1                    <------ZmHOX2a(1) --------->ARR14(2) <---------At5g28300
--->ARR14(2)<---------At4g35610                 <---------TOE2(3)   <---------ARR11(2) <---------LBD16
->TEIL      --------->At4g35610           <---------GLK1(2)<---------WOX13(2)  --------->ANAC58 <---
----ARR11(2)<---------ZAT2  <-------GAMYB--------->YAB5 <---------MYB52(1)  --------->ANAC46<-------
---CCA1(2)  --------->ZAT2 <---------ANAC46--------->GLK1(2)  <-----------GT1------->GAMYB <--------
 
ccttgcttcaccgagagctggggagatttgccgttgaaagaaaacgattctgaggatatgttagtttacggtatcctcaacgacgcctttcacggcggtt  9759700
                                                                                    --------->GLK1(2)
                                                                                   --------->ARR14(2)
                                                                                   <---------ARR11(2)
                                                                                   <---------GLK1(2)
                                                                                   --------->ARR11(2)
   <---------RAP2.6(3)                                                             <---------RVE1(2)
  --------->DEAR3(1)                                                               <---------ARR14(2)
  --------->RAP2.3(3)                                                            <---------MYB46(3)
  --------->RAP2.3(2)                                                          <-------GAMYB
 --------->RAP2.3(1)                                                           --------->At5g28300
 --------->ATERF1(1)                                                           <------NtERF2
 <------NtERF2                                                                <---------MYB46(3)
--------->At4g35610                                                          <---------DREB2C(2)
<---------At4g35610                                                          <---------ANAC46
<---------ATERF1(1)                                                          --------->ALFIN1
-------ANAC58                            --------->LBD16                     <---------AtMYB61
-------ANAC58                           --------->HSFB2a(2)                  <---------DEAR3(1)
----MYB52(1)                        <----------DOF2                         <---------ABI4(1)
---P <---------DOF5.7(1)           <---------DOF5.7(1)                    <---------RAP2.6(2)
---MYB46(1)                 ------>ZmHOX2a(2)                             <---------RAP2.3(2)
--->ALFIN1                 <------ZmHOX2a(2)         <------ZmHOX2a(2)    <---------DEAR3(1)
-GAMYB                    --------->ARR14(2)        --------->ARR11(3)   <---------LBD16
--MYB46(3)                <---------ARR14(2)        <---------GATA12    <---------ANAC58
->MYB55(2)                <---------ARR11(3)        --------->GATA12    <---------ANAC46       -----
->AtMYB77                 <-----------ARR10       <---------YAB1        <---------ANAC58      <-----
---MYB83                  --------->GATA12   <---------ZAT6    --------->LBD16<---------DEAR3(2)
--DEAR3(2)                <---------GATA12--------->LBD16    <---------LBD16------>NtERF2    -------
-DEAR3(1)                 --------->ARR11(3) <---------KAN1--------->GLK1(2)<------NtERF2  <--------
 
gggagccgtcttcttcgtcttccgacgaagatcgtagctctttcccgagtgttaagatcgagactccggagagtttcgcggcggtggattctgttccggt  9759800
<- Previous    Next ->

AGI:  At4g17500.1   
Description:  ATERF-1 (ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR 1); DNA binding / transcription activator/ transcription factor. Identical to Ethylene-responsive transcription factor 1A (ERF1A) [Arabidopsis Thaliana] (GB:O80337;GB:Q93Z36;GB:Q9SUK1); similar to ATERF-2/ATERF2/ERF2 (ETHYLENE RESPONSE FACTOR 2), DNA binding / transcription activator/ transcription factor [Arabidopsis thaliana] (TAIR:AT5G47220.1); similar to ethylene-responsive transcription factor 1A [Medicago truncatula] (GB:ABO40237.1); contains InterPro domain DNA-binding, integrase-type; (InterPro:IPR016177); contains InterPro domain Pathogenesis-related transcriptional factor and ERF,
Range:  from: 9759337    to: 9760353    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version