AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
               --------->GATA12
               <---------ARR14(2)
               --------->ARR14(2)
               <-----------ARR10
          <---------At4g35610
          --------->At4g35610                                                           --------->ZAT6
        <XXXXXXXXXXXXXXXXXXXXMIR835-3P                                        --------->GLK1(2)
     <----------DOF2                                                         <---------ARR11(3)
    <---------DOF5.7(1)   --------->YAB1                      <----------DOF2--------->ARR11(3)
---------->HVH21     ------------>CBF  <----------DOF2  <---------At4g35610  <---------GLK1(2)
------>TGA1a   ------->TEIL  --------->KAN1    ------>ZmHOX2a(1)             <---------RVE1(2)
-------TGA1a  <---------CCA1(2)       <---------DOF5.7(1) <----------DOF2   <---------RVE1(1)
 
tcgtgactctttcttctgaatcttctcaatcgaaattcttctctttagtcctcccattctgctttctttgatttcacagagattttgagggacactacct  8344200
                                                                                          --------->ARR14(2)
                                                                                          <---------ARR14(2)
                                                                                          <---------ARR11(2)
                                                                                          --------->ARR11(2)
                                                                                          --------->RVE1(2)
                                                                                         <---------CCA1(2)
                                                                                       --------->ANAC55(2)
                                                               <---------MYB46(3)      <---------ANAC55(2)
                                                              <---------AtMYB61 ====================
                                                             <-------GAMYB      ------>ZmHOX2a(2)
                                                             <---------MYB52(1)<------ZmHOX2a(2)
                                                            <---------DEAR3(2) =====================
                                                           <---------DEAR3(1) --------->ARR11(2)
                                                           <---------DREB2C(2)<---------ARR14(2)
                                                           <---------DEAR4(1) <---------ARR11(2)
                                                           <---------At1g77200--------->GATA12
                                                          --------->DDF1      --------->ARR14(2)
                 ------->TEIL                            <-----------HVH21    <---------GATA12
          <---------RVE1(2)                             <-----------RAV1(1)   <---------ARR11(3)
   <----------DOF2             --------->TOE1(2)    <---------AHL20(3)        --------->ARR11(3)
  <---------DOF5.7(1)    --------->ANAC58           --------->AHL20(3)   ==============HOX2a_HOX2a
 --------------->AGL15   --------->ANAC46           <---------AHL20(2)   =============HOX2a_HOX2a
 <---------------AGL15   --------->ANAC58         <---------AHL20(2)     <------ZmHOX2a(1)<---------
 
ctctctctttatagatagtgtatgtaacaagaaacctagaaacaattgtatatataaaaatgtcggtggttttataggagggatctaggcccgtatcagg  8344300
                                                       --------->GLK1(2)
                                                       --------->RVE1(2)
                                                       <---------GATA12
                                                       --------->GATA12
                                                    <---------AHL25(2)
                                                    <---------AHL20(3)
                                                    --------->AHL25(1)
                                                    <---------AHL25(1)
                                                    <---------AHL25(3)
                                                    --------->AHL25(2)
                                                    --------->AHL20(3)
                                                    --------->AHL20(2)
                                                    <---------AHL20(2)
                                                  <---------WOX13(2)
                                                <---------AHL25(3)
                                               --------->AHL20(1)
                                               --------->AHL20(2)
                                               <---------AHL20(1)
                                               <---------AHL20(2)
                                               --------->AHL25(3)
                                               <---------AHL20(3)
                                               <---------AHL25(1)
                                               --------->AHL20(3)
                                               --------->AHL25(1)
                                               --------->AHL25(2)
                                   ---------->ID1 --------->WOX13(2)
                         ---------->ID1      --------->WOX13(2)
                   --------->AHL25(2)     <---------ATHB12   <---------WOX13(2)
                   <---------AHL25(2)    --------->RVE1(2)   --------->WOX13(2)
================HOX2a_HOX2a   <----------DOF2<---------WOX13(2)                                 <---
================HOX2a_HOX2a  <---------DOF5.7(1)--------->AHL20(2)                              ----
--HVH21  <------ZmHOX2a(1)<-----------------AGL1<---------AHL20(2)                     <---------YAB1
 
cccattgcaagaggaaattcaaaattttgtcttcttttggcccaaatcaatttaataaaatctgaattaggggttttgttttttgatttcatgatataaa  8344400
                                                  --------->DOF5.7(1)
                                                 --------->DOF5.7(1) --------->ARR14(2)
                                                <---------ICU4       --------->ARR11(2)
                                                ---------->DOF2      <---------ARR14(2)
                                             --------->YAB1     --------->MYB52(1)
         --------->DAG2                     <---------------AGL15    <---------ARR11(2)
        ---------->DOF2                     <---------YAB1     --------->DOF5.7(1)             <----
-------ID1           <-----------GT1      --------->YAB1  ----------->GT1                      <----
----->ANAC46 <-------TEIL              <----------DOF2 --------->MYB52(1)                     <-----
 
cgacaaaaaccaaaagtacatatataaccagaactcaagagtcttttataataaaggcaaaccgaaaaaacagaaccggttatcaagtctctctcttcct  8344500
                                                                       --------->ANAC46
                                                                       <---------YAB1
                                                                       --------->ANAC58
                                                                       --------->ANAC58
                                                                <-----------HVH21
                                                              <-------MYC4
                                                              ------->MYC3
                                                              <-------MYC2          <-----------GT1
                                                              ------->PIF5        <---------YAB1
                                                              <-------MYC3       --------->AHL20(3)
                                                              <-------PIF5       --------->AHL12(2)
                                                              ------->MYC4       <---------AHL20(3)
                                                              ------->MYC2       <---------AHL12(2)
                                                             =======================================
                                                             <---------TGA1a    <---------ICU4
                                                             <---------O2      --------->ICU4
                                                             --------->TGA1a --------->YAB5
                                                             --------->ANAC55(2)<--------HAHB4
                                                             --------->O2<---------ARR14(2)
                                                             >>>>>>>>>>HY5--------->CCA1(2)
                                                           <---------ALFIN1 <---------YAB1
                                                           <------------OsbHLH66--------->YAB1    --
                         --------->YAB1                 -------->P--------->bZIP60(1)   ============
                        --------->ICU4  --------->KAN1<---------MYB111(1)--------->ARR11(2)     ----
                      --------->YAB1   ------------>CBF ===============MYC_MYB <---------YAB1   ----
-----DOF5.7(1)     ----------->GT1    --------->ANAC58--------->MYB46(3) <---------ARR11(2)   ------
------DOF2  --------->GATA12--------->TOE2(3)       --------->YAB5<---------bZIP60(1)   ------>ZmHOX2a(1)
----DOF5.7(1)  <---------ALFIN1       --------->ANAC58<---------MYB52(2) --------->ARR14(2)   <-----
 
tttctatccaaataacatccacttgtaataatcttatcgacaaacaatcgacctataactacccacgtgtcatcacgatacgattattatcctctctgat  8344600
                                                             --------->GATA12
                                                             <---------ARR14(2)
                                                             <---------GLK1(2)
                                                             <---------GATA12
                                                             --------->ARR11(2)
                                                             <---------ARR11(2)
    --------->ANAC58                                         --------->ARR14(2)
    --------->ANAC58                                         <---------RVE1(2)
   ------->TEIL                                             <------NtERF2
 ------->GAMYB                                            <---------ANAC46                         -
--------->MYB46(3)                                        <---------ANAC58                        <-
<---------MYB52(2)                         --------->HSFB2a(2)                              <-------
=========MYC_MYB                 <----------DOF2          <---------ANAC58         --------->ZAT18--
------->MYB52(1)                <---------DOF5.7(1)      <---------LBD16          <------ZmHOX2a(1)<
===HOX2a_HOX2a                  <---------DAG2    ---------->DOF2              <------ZmHOX2a(1)  --
-->ZmHOX2a(2)              <---------HSFB2a(2)--------->GATA12      <---------WRKY12     --------->DOF5.7(1)
----->MYB46(3)             --------->HSFB2a(2)<---------GATA12      <---------WRKY38(1)---------->DOF2
--->GATA12             <----------DOF2---------->ID1--------->DOF5.7(1) --------->YAB5 =============
----GATA12 *TSS       <---------DOF5.7(1)  ------>ZmHOX2a(1)--------->KAN1  <-----------RAV1(2)   <-
 
ccaacggacccaaaacatctatctctctttctcgaccttttgtctcctcgatctaaagatggcggattcggacaacgattcaggaggacacaaagacggt  8344700
            <-------MYC3
            <-------MYC2
            ------->MYC3
            ------->MYC2
           --------->ANAC58                            --------->YAB5
           --------->ANAC55(2)                         --------->YAB1
           --------->ANAC46                           <------ZmHOX2a(2)
           <---------ANAC55(2)                       <---------ARR11(3)
           <---------TGA1a                          <------ZmHOX2a(1)
           <---------O2                           <---------TOE1(2)
           --------->TGA1a                      --------->At4g35610
           --------->O2                      --------->DOF5.7(2)
           --------->bZIP60(2)              --------->TOE1(3)                           --------->RVE1(2)
         <------------OsbHLH66              --------->TOE2(3)                         --------->GLK1(2)
         <---------ALFIN1                 <---------TOE1(3)                           <---------ARR11(3)
      ----------->HVH21                   <---------TOE2(3)                    --------->ANAC58
-------->KAN1                            <---------DOF5.7(2)                   --------->ANAC58
--------ARR14(2)                         --------->MYB52(1)     --------->ANAC58      --------->ARR11(3)
--DEAR3(1) --------->ANAC58          ======================HOX2a_HOX2a   ------>ZmHOX2a(1)
------->ARR11(2)                     ------>ZmHOX2a(2)==========================HOX2a_HOX2a
---------GLK1(1)                    =======================HOX2a_HOX2a  --------->TOE1(2)    <------
------->ARR14(2)        <------MYB83<------ZmHOX2a(2)--------->ARR11(3) --------->TOE2(2)    <------
=====================bZIP_DOF <-----------GT1<---------MYB52(1) --------->ANAC58      --------->RVE1(2)
--------ARR11(2)        <------MYB46(1)--------->DOF5.7(2)    ---------->DOF2 --------->SPL7(1)<----
 
ggaaatgcttcgacacgtgagcaagataggtttctaccgatcgctaacgttagcaggatcatgaagaaagcacttcctgcgaacgcaaaaatctctaagg  8344800
                                                                                                 ---
                                                                                              ------
                                                                                             <------
                                                                                            <-------
                                         <-------TEIL                                      ---------
                              --------->GLK1(1)                  --------->O2              ---------
      --------->MYB52(1)      <---------GLK1(1)             ----------->HVH21              ---------
     --------->ARR11(1) --------->ARR11(2)                <---------At4g35610       ================
 ---------->DOF2        --------->ARR14(2)                --------->At4g35610       ================
---TOE1(3)              <---------ARR11(2)         --------->ALFIN1                 <------ZmHOX2a(1)
---TOE2(3)              <---------ARR14(2)        <-----------HVH21 <-----------HVH21     --------->WOX13(1)
--ZmHOX2a(1)       <---------KAN1--------->YAB1<---------LBD16   <---------O2   --------->DOF5.7(1)-
 
atgctaaagaaacggttcaagagtgtgtatcggaattcataagtttcatcaccggtgaggcttctgacaagtgtcagagagagaagaggaagacaatcaa  8344900
      ------>ZmHOX2a(2)
     <------ZmHOX2a(2)
    --------->ARR14(3)
    <---------ARR14(3)
    <---------GATA12
    --------->ARR11(3)
    --------->GATA12
    <---------ARR14(2)
    --------->ARR14(2)   --------->ANAC46
    <---------ARR11(3)   --------->ANAC58
---->GAMYB          --------->YAB5                                                   --------->ALFIN1
--->MYB52(1)       --------->WRKY38(1)                                             <---------ANAC46
---WRKY38(1)     --------->At4g35610                                               <------MYB46(1)
--ATHB12         <---------At4g35610                                               <------MYB83
>ANAC58   <----------DOF2--------->ANAC58                                         <-----------------
>RVE1(2) xxxxxxxxxxxxxxxx>smallRNA(i)                                             <---------DEAR3(1)
>ANAC58  xxxxxxxxxxxxxxxx>smallRNA(s)                                             --------->ALFIN1
=============HOX2a_HOX2a<---------ZAT14       --------->ALFIN1                    <---------AtMYB61
============HOX2a_HOX2a --------->ZAT18     <---------ANAC46                      --------->MYB111(2)
---------->HVH21<---------DEAR3(1)     <------ZmHOX2a(1)               ---------->DOF2     <------ZmHOX2a(1)
 
cggtgacgatcttctttgggcgatgactacgctagggtttgaggactacgtggagcctctcaaggtttatctgcaaaagtatagggaggtggaaggagag  8345000
                                                     <---------ZAT2
                                                     --------->ZAT2
                                                 --------->ALFIN1
                                                <------NtERF2
                                                <-------GAMYB
                                               <---------MYB46(3)
                                              --------->ALFIN1
                                              <---------DREB2C(2)                             <-----
                                             <------NtERF2                               --------->ABI4(2)
                                          --------->ATERF1(1)                            <---------MYB46(3)
                                          <------ZmHOX2a(1)                             <---------DEAR3(1)
                                        --------->ALFIN1                          <---------SPL7(1)
                                       <------ZmHOX2a(1)                        --------->GATA12
              <----------ID1      --------->ALFIN1   <---------At4g35610  --------->GLK1(1)   <-----
              <----------ARF1   <------MYB83 <---------ABI4(1)            <---------GLK1(1)   <-----
           <------NtERF2        <------MYB46(1)<---------ORA47(2)         --------->ZAT2<---------AtMYB61
         <-----------RAV1(2)   <---------AtMYB61--------->ATERF1(1)       <---------ZAT2--------->ALFIN1
      --------->ANAC58         --------->DOF5.7(1)   --------->At4g35610  <---------At4g35610 <-----
      --------->ANAC46       <------ZmHOX2a(1)<---------DEAR3(1)          --------->At4g35610<------NtERF2
      --------->ANAC58     --------->ANAC58--------->ALFIN1             <------ZmHOX2a(1)--------->MYB55(2)
     <---------LBD16       <---------TOE2(3) --------->ATERF1(1)   --------->ALFIN1 ------->TEIL ---
------TaNAC69(2)           --------->ANAC58<---------DEAR3(1)--------->ALFIN1  <------------------SPL14
 
aagactactacggcagggagacaaggcgataaggaaggtggaggaggaggcggtggagctggaagtggaagtggaggagctccgatgtacggtggtggca  8345100
<- Previous    Next ->

AGI:  At4g14540.1   
Description:  CCAAT-box binding transcription factor subunit B (NF-YB) (HAP3 ) (AHAP3) family. Identical to Nuclear transcription factor Y subunit B-3 (NFYB3) [Arabidopsis Thaliana] (GB:O23310); similar to CCAAT-box binding transcription factor subunit B (NF-YB) (HAP3 ) (AHAP3) family (Hap3b) [Arabidopsis thaliana] (TAIR:AT5G47640.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN61076.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO41159.1); contains InterPro domain Transcription factor, NFYB/HAP3, conserved site; (InterPro:IPR003956); contains InterPro domain Transcription factor CBF/NF-Y/archaeal histone; (InterPro:IPR003958);
Range:  from: 8344612    to: 8345214    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version