AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                        <---------At4g35610
                                                                                        --------->At4g35610
         <-----------HVH21                                                              --------->ZAT2
        <----------DOF2                                                                 <---------ZAT2
   --------->HSFB2a(1)                                 <------ZmHOX2a(1)               ------->TEIL
   <---------HSFC1(2)                                --------->ALFIN1               --------->ANAC46
   --------->HSFC1(2)                         <---------LBD16                       <---------ANAC55(2)
--------->LBD16                               <---------At4g35610                   <---------O2
-------->ANAC46         --------->HSFC1(2)<-----------HVH21                         --------->ANAC58
----->RVE1(2)           <---------HSFC1(2)<-----------TGA1                          --------->ANAC58
------ARR14(2)          <---------HSFB2a(1)   --------->At4g35610                   --------->O2
----->ARR14(2)          --------->HSFB2a(1)----------->HVH21                      <---------ALFIN1
----->GATA12      --------->LBD16 --------->KAN1    <------ZmHOX2a(1)          <------ZmHOX2a(1)   <
------GATA12      <-----------HVH21      --------->ANAC46                    --------->MYB59    ----
-->AHL20(2)   --------->DEAR3(1) <---------YAB5 --------->LBD16            <---------MYB52(1)   ----
 
atccgaaactcctttcacctccgtcgaagcttcttcaacattctccgtcaccggaggaggagggaagttaagctctgcgttaggaccacgtagctgaata  6795400
                                                                                        --------->DREB2C(2)
                                                                                        --------->RRTF1(2)
                                                                                        --------->RRTF1(3)
                                                                                        --------->RAP2.3(2)
                                                                                        --------->RAP2.3(3)
                                                                                        --------->DEAR3(1)
                                                                                        <---------ATERF1(2)
                                                                                        --------->ATERF1(2)
                                                                                       --------->RAP2.3(1)
                                                                                       --------->ERF1
                                                                                       --------->ORA47(2)
                                                                                       --------->DEAR4(2)
                                                                                       --------->RRTF1(1)
                               --------->DEAR3(1)                                     --------->At4g35610
                               <---------ANAC58                                       --------->LBD16
                               <---------O2                                           <---------At4g35610
                               <---------ANAC46                                       ------>NtERF2
                               <---------ANAC58                            ------>ZmHOX2a(2)
                               --------->TGA1a                            <------ZmHOX2a(2)
                               ==================bZIP_DOF     <---------O2<---------GLK1(1)
                               --------->O2                   <---------ANAC55(2)     --------->ABI4(1)
                               <---------TGA1a                --------->O2--------->GLK1(1)
                             ------>NtERF2          ------>MYB46(1)       <---------KAN1--------->RAP2.6(2)
                             --------->LBD16      --------->AtMYB61      --------->ARR14(2)
                            --------->DEAR3(1)    <---------MYB59        --------->ARR11(3)
                    <---------ZAT2             ------>MYB83   --------->ANAC58        <---------ATERF1(1)
                    --------->At4g35610        ------>MYB46(1)--------->ANAC58       --------->ANAC46
                    <---------HSFC1(2)         --------->MYB52(1)        <---------ARR11(3)
      --------->YAB1<---------HSFB2a(1)      <---------MYB59<---------ALFIN1         --------->DEAR3(1)
    <---------DOF5.7(2)     --------->ANAC46 <---------MYB111(1)         <---------ARR14(2)
  --------->DOF5.7(2)     ------>ZmHOX2a(1)  <---------MYB52(2)          --------->ARR11(2)
 ========================================bZIP_DOF--------->MYB46(3)      <---------GATA12 <------NtERF2
 <----------DOF2    --------->HSFB2a(1)      <---------MYB46(2)          --------->GATA12--------->ABI4(1)
<---------ANAC46    --------->ZAT2          <---------ANAC55(2)          <---------AGP1--------->ATERF1(1)
-------TEIL         <------NtERF2 <-----------HVH21 ------>MYB83   <---------REM1(2)<---------LBD16
----->ZAT2          <---------At4g35610    ------->TEIL--------->TOE2(3) <---------ARR11(2)
----->At4g35610     --------->HSFC1(2)---------->DOF2  --------->TOE1(3)<---------CCA1(2)------>NtERF2
 
gctgcgttatcgtaaacaatggcagcttcctccgccgtgtcaaaagtacctaaccaaaccctaacacgtctactcggatctctaatctccgccgcccatt  6795500
                                         <------NtERF2
                                         <---------------------WRI1
                                        <-----------HVH21
                                        ------>NtERF2
                                       --------->DEAR3(1)
                                     <---------ATERF1(1)
                                     <---------RAP2.3(1)
                                     ------>NtERF2
                                    <---------DEAR3(1)
                          --------->HSFC1(2)
                          <---------HSFC1(2)
                      --------->ANAC58--------->ATERF1(1)
                      --------->ANAC58<------NtERF2
                      --------->ANAC46--------->RAP2.3(1)
                     --------->LBD16--------->DEAR3(1)
                 --------->ANAC46 <-----------HVH21--------->AtMYB61
                 --------->ANAC58--------->ANAC46 --------->MYB46(3)        <----------DOF2
               <---------ALFIN1 ------>ZmHOX2a(1) <---------MYB55(2) ------->GAMYB          <-------
        <----------DOF2   --------->HSFB2a(1)    -------->P ----------->GT1<---------DOF5.7(1)  <---
       <---------DOF5.7(1)<---------HSFB2a(1)   ------->GAMYB--------->At5g28300 <------------------
 <---------ALFIN1--------->ANAC58--------->O2  --------->MYB46(3)    <---------ZAT18  <<<<<<<<<TBF1
 
ttccccacggtctttgcctcactccacgaaacttcctcgtcgccgtcgtaacaaccactggaacagtaacaacgcgcttctttctcttcttcttcatcgg  6795600
                             <---------ALFIN1
                         --------->MYB46(3)
                        --------->ANAC58            --------->ZAT6
                        --------->ANAC58   ------->TEIL  <---------O2
               --------->MYB52(1)       <---------ANAC55(2)
              --------->AtMYB61         --------->ANAC58 --------->bZIP60(1)
       --------->YAB1<---------KAN1     --------->ANAC46 --------->O2
  <----------DOF2    <---------ATHB12   --------->ANAC55(2)           <---------RVE1(2)
 <---------DOF5.7(1)--------->RVE1(2)   --------->ANAC58 <---------bZIP60(1)
--At4g35610  --------->MYB46(3)        --------------->AtSPL3    <---------ANAC46               <<<<
------GLK1(2)<---------ABI4(2)         --------------->AtSPL8 <---------MYB52(1)   --------->RVE1(2)
------ANAC81 <---------MYB55(2)     <-----------HVH21 --------->ANAC46--------->ARR11(3)     <<<<<<<
 
cttctctttatcagaaaccaccgaatcaagcaccacttccttcacgtacttcttaacacgacgtcgttttgtagataatgcatcaaaatcaacttcttct  6795700
                     <---------ANAC58
                     <---------ANAC55(1)
                     <---------ANAC55(2)
                <-----------RAV1(1)
              <---------KAN1
             <---------ARR11(2)
             <---------GATA12
             --------->ARR14(2)
             --------->GLK1(2)
             --------->ARR11(2)                    --------->GLK1(2)
             --------->GATA12                     <---------GLK1(2)
             ------->TEIL    <------ZmHOX2a(2)   --------->KAN1
        <---------WRKY18(1)<------ZmHOX2a(1)    ----------->ARR10
       ----------->HVH21  --------->ICU4       <---------TOE1(2)
     <---------ANAC58<---------ANAC58      <-------TEIL
     <---------ANAC58<---------ANAC46     --------->GLK1(2)
 <-----------HVH21<---------MYB52(1)     <---------GLK1(2)                                  --------
<<<<<TBF1    <---------ARR14(2)   --------->MYB52(1)                                     --------->AHL20(2)
<<TBF1<----------DOF2--------->ANAC55(2)--------->KAN1                                   <---------AHL20(2)
 
tcttcgtcgcttgacgaatctgttgcgtaaggatcagtaacagagattcgtaagattcttgggagagaaactttcttctctgtctccattttttaaatct  6795800
                                                               <---------AHL20(2)
                                                           <-----------TBP
                                                         <-----------TBP
                                                    <---------TOE1(2)
                                                   <---------ANAC46
                                                 <---------O2----------->TBP
                                                 <---------bZIP60(2)
                                                 <---------TGA1a---------->DOF2           ----------
                                                 <---------ANAC58                       --------->DOF5.7(1)
                                                 ================================================bZIP_DOF
                                                 ==========================bZIP_DOF    --------->DOF5.7(1)
                                                 <---------ANAC46                 --------->DAG2   -
                                                 <---------ANAC58                ---------->DOF2 ---
                                          <----------DOF2--------->AHL20(2)    <------ZmHOX2a(1)----
 <----------DOF2        <-----------GT1   =================bZIP_DOF          --------->MYB59    ----
->GATA12      <---------YAB1  <---------ANAC46<-----------RAV1(1) --------->DOF5.7(1) ---------->DOF2
 
ctctctttaaaactgttgtaatagttttaacttatgtgtgttcttctttgtgtcgtgtgtttatatataaagaccaaagttaggaaaagtaaagggcaaa  6795900
                                                                ---------->DOF2
                                                             --------->LBD16
                                                            <---------LBD16
                                                            --------->LBD16
                                                           <---------LBD16
                                                     <---------ARR14(3)
                                                     <---------GLK1(2)
                                                     --------->ARR11(3)
                                                     <---------ARR11(3)
          ----------->GT1                            --------->ARR14(3)
        ----------->GT1                              <---------ARR14(2)
    ---------->DOF2                                  --------->ARR14(2)
   <---------KAN1                                    --------->GATA12                           ----
->GT1 --------->DOF5.7(1)                            <-----------ARR10                    <---------AHL20(2)
---------->GT1                                       <---------RVE1(2)                <----------DOF2
------>DOF5.7(1)                <---------WOX13(1)   <---------GATA12                 <---------DOF5.7(1)
----->DOF5.7(1)   ----------->GT1      <----------DOF2    <---------LBD16             <---------DAG2
------>DOF2    <------------CBF<------------CBF    ----------->ARR10      ---------->DOF2 --------->AHL20(2)
 
aaaggaataaagagagaaaattggtaaaacaagagattgatgctttgtaacaagaagattttcccgggaaagttgaagaaagcagagagcttttttaata  6796000
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                   -
                                                                                                   <
                                                           --------->WOX13(2)                      <
                                                        <---------------AGL15                      -
                              <---------ZAT18          <-----------------AG                       <-
                              --------->ZAT18          <-----------------AGL1                -------
                             <------ZmHOX2a(1)         <-----------------AGL3               --------
                     <---------REM1(1)               <-----------GT1                        ------>ZmHOX2a(1)
                   <------MYB46(1)               <----------DOF2                           ---------
                   <------MYB83             --------->GLK1(1)                         --------->AHL12(1)
                   <---------ANAC46---------->DOF2<---------DOF5.7(1)                 --------->KAN1
                  --------->MYB111(2)     <------ZmHOX2a(1)<---------WOX13(2)         <---------AHL12(1)
    --------->HSFB2a(2)   <------ZmHOX2a(1) <---------GLK1(1)               <----------DOF2<--------
----->KAN1        --------->MYB46(2) --------->DOF5.7(1)--------------->AGL15    <---------TOE2(3)--
 
tatgcttatggaatcaagagtttggtgaaggaggacactaaagaaggagatgcttttttcttatttagggatgaaatttcttttaagaaatattcctggg  6796100
<---------AHL25(2)
<---------AHL25(3)
<---------AHL20(2)
<---------AHL12(3)
--------->AHL25(1)
--------->AHL25(2)
<---------AHL25(1)
--------->AHL12(3)
-------->AHL12(1)
---------AHL25(2)
-------->AHL12(2)
---------AHL12(1)
-------->AHL25(3)
-------->AHL25(2)
---------AHL25(1)
---------AHL12(3)
-------->AHL25(1)
--------KAN1                                       --------->DOF5.7(1)
-->LBD16             --------->DAG2              ---------->DOF2     --------->DOF5.7(1)
->LBD16       ---------->DOF2             ----------->GT1          ---------->DOF2
>TOE1(2)  <---------At4g35610           --------->DOF5.7(1)      --------->ARR11(3)
-LBD16    --------->At4g35610    --------->At4g35610          ------------------------>ANAC81
------->AHL12(1)    ---------->DOF2   ---------->DOF2      >>>>>>>>>TBF1     --------->At4g35610
 
aatttttttttgcagcgaaaagaaaaagtttagagcagaagaaaagagtgacaaaagatgaagaagaagataaagagagaagcagagcaaaacatgtaag  6796200
                                                              <-----------GT1
                                                         <---------ANAC46
                                                        <------NtERF2
                                                        ------>NtERF2
                                                       --------->LBD16
                                                       <---------RAP2.3(1)
                                                      <---------RRTF1(2)
                                                   <---------ARR11(2)
                                                  --------->ATERF1(1)
                                                  <-------GAMYB
                                                 <---------ATERF1(1)
                                                 <---------MYB46(3)
                                                 <---------DEAR3(2)
                                                 --------->MYB55(2)
                                     <---------KAN1--------->ARR11(2)           <---------------AGL15
                                    <---------RVE1(2) <---------RAP2.3(2)      <---------YAB5
                                    <---------ARR14(2)<---------ANAC46 <---------DOF5.7(1)
                                    --------->ARR11(3)<---------RAP2.3(3)      <---------YAB1
                                    <---------ARR11(3)<---------RAP2.6(2)      ----------------->AGL1
                                    --------->ARR14(2)<---------DEAR3(1)<---------DOF5.7(1)
                                   <------ZmHOX2a(1) <---------LBD16  <---------DOF5.7(1)
                             <---------YAB1     <---------DEAR3(1)    ------>ZmHOX2a(1)
     <---------KAN1        <----------DOF2    ------------>AtMYB77    <----------DOF2<---------TOE2(3)
 
tgaagagagtgactctgaatagaacagagacttttataggatattgaaacggcggttgcggcgttttacaatccttttttttgtcattaagggaaacaaa  6796300
<- Previous    Next ->

AGI:  At4g11140.1   
Description:  CRF1 (CYTOKININ RESPONSE FACTOR 1); DNA binding / transcription factor. Identical to Ethylene-responsive transcription factor CYTOKININ RESPONSE FACTOR 1 (CRF1) [Arabidopsis Thaliana] (GB:O82503); similar to CRF2 (CYTOKININ RESPONSE FACTOR 2), DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT4G23750.2); similar to CRF2 (CYTOKININ RESPONSE FACTOR 2), DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT4G23750.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO65840.1); contains InterPro domain DNA-binding, integrase-type; (InterPro:IPR016177); contains InterPro domain Pathogenesis-related transcriptio
Range:  from: 6794772    to: 6795789    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version