AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                   <
                                                                                <---------ATHB12   -
                       --------->TOE2(3)                          --------->RVE1(2)                -
                 --------->YAB1                                --------->ARR14(2)                  <
                <<<<<<<<<ARR2                               --------->ANAC55(2)--------->ANAC46 ----
                <---------ATHB12                            <---------ANAC55(2)--------->ANAC58 <---
               --------->RVE1(2)                       --------->ARR11(2)      --------->ANAC58 ----
    --------->At4g35610--------->TOE1(3)   --------->AtLEC2 <---------ANAC46 <---------ALFIN1   ----
----TEIL   --------->YAB1           ---------->DOF2  --------->At5g28300  --------->ANAC46   -------
---ZAT6  --------->RVE1(2)---------->DOF2  <---------ANAC55(2) <---------ARR14(2)   <---------ICU4 -
 
tcatcacagctatatcacaatcaaaaccataaatcacagcaaagtcatgtaaacactgtaactgcgtaatctctaaaaccccactcaacatttccaacaa  2135800
       <---------LBD16
     <---------ARR14(2)                             <---------GLK1(2)
     --------->ARR14(2)                            --------->HSFC1(2)
     --------->ARR11(2)                            <---------HSFC1(2)
     <---------ARR11(2)                           --------->ANAC58
    XXXXXXXXXXXXXXXXXXXX>MIR165A/B                --------->ANAC58
   ----------->HVH21                            <---------KAN1                                    --
---------ARR11(2)        --------->GATA12    ------->GAMYB                               <---------ICU4
-------->MYB52(1)        <---------GATA12   <---------MYB55(2)                           --------->YAB1
-------->ARR11(2)       --------->GLK1(1)   <---------MYB52(2)                        --------->WOX13(1)
---------ARR14(2)       <---------GLK1(1)   --------->MYB46(3)                      --------->MYB46(3)
----->ANAC58         --------->LBD16       ------>MYB83                 <---------ANAC58<---------YAB5
------ANAC55(2)     --------->LBD16        ------>MYB46(1)              <---------ANAC58<---------ATHB12
----->ANAC58       ----------->RAV1(2)    --------->MYB52(1)  --------->YAB5       --------->ANAC58
----->ANAC46       <---------LBD16       --------->DEAR3(1)  <---------ATHB12      --------->ANAC58
-->MYB46(3)    --------->GATA12         --------->MYB46(3) ----------->RAV1(1)     --------->ANAC46
-------->ARR14(2)------>ZmHOX2a(2)   --------->WRKY38(1)--------->HSFB2a(2)       ------->GAMYB   <-
 
cgtaaccggacccggtttgatcccctgaaatctcatctcgttcaccaacgaacaagcttctccaacaattccagcgcgtgagtaacacccaatcatcgca  2135900
                             ------>ZmHOX2a(1)
                             <---------HSFB2a(2)
                         <---------ARR11(2)
                         --------->ARR14(2)
                         --------->ARR11(2)
          --------->GATA12   --------->HSFB2a(2)                                      --------->YAB1
       <---------ALFIN1  <---------ARR14(2)                                --------->ATHB12
       --------->AtMYB61--------->GLK1(1)                                 <---------YAB1
      --------->ANAC46  <---------KAN1                                    <---------YAB5
     ----------->RAV1(1)<---------GLK1(1)                                 --------->DOF5.7(1)
   <---------ZAT18  --------->ANAC46                                      --------->ICU4
   --------->ZAT14  --------->ANAC58                                    ---------->DOF2
   --------->ZAT18  --------->ANAC55(2)                                <---------KAN1 --------->YAB5
   <---------ZAT14  --------->ANAC58           <---------KAN1      <---------ANAC46  <---------ATHB12
------->ZAT14       <---------ANAC55(2)   --------->LBD16      <<<<<<<<<SARD1<---------WOX13(1)
--------ZAT14    ----------->HVH21   <----------DOF2           <<<<<<<<<CBP60g <---------WRKY18(1)
 
gtccagtgcaccacatctctctcacgcatttcctcgaacactttccgagcatgagccaagagtccaaatttcgcataaagattgaccaatgaagatgata  2136000
                                                               <----------CDC5
                                                               <------NtERF2
                                <---------ZAT2                --------->At4g35610   --------->HSFB2a(2)
                                --------->ZAT2               <---------DEAR3(1)     <---------HSFB2a(2)
                            --------->GLK1(2)         --------->DOF5.7(1)        <----------DOF2
   <---------GATA12   <---------TOE2(3)             ---------->DOF2           --------->ANAC58     -
  <---------GLK1(1)  <---------DOF5.7(2)          --------->AtMYB61           --------->ANAC58   ---
 
tgtagaaatctgaagagaacccattaacgagaacctgctggtgaatcgagagaccaaaagagaggcgctgaagagaagcacaagctttgagaagactagg  2136100
                            <---------ANAC58                       ------>ZmHOX2a(2) ----------->GT1
                            <---------ANAC46                   <---------YAB1        --------->YAB5
          <-----------RAV1(2)                              <---------ANAC58     <---------YAB1
   ---------->DOF2    --------->ATHB12               --------->ARR11(3)       --------->YAB5
---------->GT1<--------P    <---------ANAC58<---------KAN1 <---------ANAC58  <---------YAB1
------->DOF2<---------ANAC55(2)<---------ZAT2--------->YAB5<---------ANAC46  ----------->GT1
 
gaaagtaaaagtatcaggtaagagtttattggcgagcatggaagagaatgttgagagaacttgcttgtgatcgccatgagatgataaatggttaatgtga  2136200
                                                                                               <----
                                                                                           <--------
                                                                                          <---------YAB1
                                                             ------------>CBF         --------->TOE2(3)
                                        --------->YAB1      --------->YAB1            --------->YAB1
                                       <---------YAB1   <---------YAB1             --------->WOX13(1)
                                    <---------YAB1     ------------>CBF          ------------>CBF
                                 <---------ARR14(2)----------->GT1              --------->RVE1(2)
 
gagttgaagtacttggtggagttcaacacagacgaagttctgatcatagctccatggttacaattacaatgaaatcgtctccatatcaatcttattacag  2136300
                                                                                ------>MYB46(1)
                                                                                ------>MYB83
                                                                      --------->MYB52(1)
          <------------CBF                                            ------>MYB46(1)
        --------->ARR11(3)                                            ------>MYB83
        --------->ARR14(2)                                          --------->AtMYB61
        <---------ARR11(3)                                  ------>MYB83      --------->AtMYB61
        <---------ARR14(2)                                <---------MYB59     <---------MYB59
        <---------RVE1(2)                                --------->MYB46(3)  --------->MYB46(3)
        <---------ARR14(3)                        -------->P------>MYB46(1)------>MYB83
        --------->ARR14(3)                    --------->RVE1(2)     <---------MYB59
-------HVH21                    --------->ANAC55(2)    --------->ARR11(2)  ------>MYB46(1)
---GT1----------->ARR10  <---------YAB5----------->GT1 <---------ARR11(2)<---------MYB59
 
tcacagaagaagatattgtatttgtgtaatggtttacttatcaggtttatatcaacccgaaccaaactaaaccaaaccgaaccaaaccaaaatttcaaac  2136400
                  <---------YAB1
                <---------ICU4
                --------->YAB1
               <---------YAB1
               --------->ICU4
              <---------AHL12(3)
              --------->AHL12(3)
              --------->AHL25(2)
              --------->AHL20(3)
              <---------AHL25(2)
              <---------AHL12(2)
              --------->AHL12(2)
              <---------AHL20(3)
             -------->ATHB1
             --------->ATHB51
             <---------ICU4
             --------->YAB1
             <--------HAHB4                                                                        <
             --------->YAB5                                                                        =
            --------->AHL25(3)                                                                 -----
            <---------AHL12(1)                                                                ------
            --------->ICU4                                                   ------>MYB46(1)  <-----
            <---------YAB5                                                   ------>MYB83--------->HSFB2a(1)
            <---------KAN1                                               ------->TEIL    <---------HSFC1(2)
        --------->ANAC55(2)                                             <---------ALFIN1 <---------HSFB2a(1)
        <---------ANAC55(2)                                           --------->RAP2.6(2)--------->HSFC1(2)
      <-----------GT1                                              --------->MYB52(1)   <---------ARR11(2)
    <---------WOX13(2)                   *TSS    --------->TOE2(3) ------>MYB83         --------->ARR11(2)
    --------->WOX13(2)              ----------->GT1              --------->AtMYB61      --------->ARR14(2)
  --------->AHL20(2)     <---------LBD16<---------WOX13(2)       <---------MYB59        <---------ARR14(2)
  <---------AHL20(2)  <---------------AGL15      --------->TOE1(3) ------>MYB46(1)  <---------------
 --------->AHL25(3)<-----------GT1<------ZmHOX2a(1) ---------->DOF2--------->ARR11(2)--------->ETT(1)
 
tatttttaattacgaattattattactcttcggagtaggaggtaactaaaaaccctaaagtcaaaaaaccaaaccgcacctatcgatgtcggaacttcca  2136500
                 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
               --------->ARR14(1)
              <---------ARR11(2)
              --------->ARR11(2)
              --------->ARR14(2)
              --------->ARR11(1)
              <---------RVE1(2)
            ----------->ARR10
           xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
         xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
         <---------ANAC46                                              --------->DAG2
    <---------ANAC58                                                  ---------->DOF2
    <---------ANAC58      --------->AtLEC2                      --------->ANAC58
    <---------ANAC46 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)      --------->ANAC58
 <---------GLK1(1)  <------ZmHOX2a(2)                         --------->ARR14(1)
 <---------KAN1--------->CCA1(2)                             --------->GATA12
 --------->GLK1(1)  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)    --------->ARR11(2)
 <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                        <---------ARR11(2)
--------->ARR14(2) --------->RVE1(2)                         <---------GATA12
<---------ARR11(2) --------->GATA12                          --------->ARR11(1)
<---------ARR11(3) <---------GATA12                          <---------ARR14(2)
<---------ARR14(2) --------->ARR11(3)                  --------->CCA1(2)
--------->ARR11(3) <---------ARR11(3)        --------->KAN1  --------->ARR14(2)                    -
------ZmHOX2a(1)<-------TEIL                 <---------AHL20(2)<-------TEIL                  <xxxxxx
===========================HOX2a_HOX2a      --------->AHL20(2)--------->CCA1(2)            ---------
---->LBD16 ================HOX2a_HOX2a<---------ARR11(2)     <---------GLK1(2)      --------->DOF5.7(1)
--->HSFB2a(2) <---------ARR14(2)      --------->ARR11(2)    --------->KAN1          --------->DAG2 -
----HSFB2a(2)<---------GLK1(1)     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)           ---------->DOF2 <
------WRI1 <------ZmHOX2a(1)<-----------------AGL3  --------->ANAC46  --------->DOF5.7(1)<---------RAP2.6(3)
 
gaggatatcgtggaggagatacgatctacttgcaaaacatggaaccatttattcaacgatacaagattcgcaaaaaagcacttcgataaagccgtaagac  2136600
               --------->YAB1
              <------ZmHOX2a(2)
             <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
             --------->RVE1(2)                                                              --------
-------->RVE1(2)             <---------TOE2(3)                      --------->At4g35610    <--------
xxxxxxxxxxxxxxxxxsmallRNA(si3)                              <---------GATA12        <---------YAB5
>SPL7(1)  <---------TOE1(2)  <---------TOE1(3)<----------DOF2     <-----------RAV1(2)<---------ICU4
-------->ARR11(3)        <---------KAN1       --------->TOE2(3)----------->HVH21 <---------KAN1
---------ARR11(3) ---------->DOF2     <---------MYB46(3)    ------->TEIL       --------->YAB1    <--
 
aatatctagctctcacgatcacaaaggaatttagggtttatttgttgaactttaatctctatggatgtaacaggtgaacttagcataatcaattctcatt  2136700
<- Previous    Next ->

AGI:  At4g04370.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT3G03580.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO69656.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 2134058    to: 2136247    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g04375.1   
Description:  pseudogene, hypothetical protein
Range:  from: 2136442    to: 2137563    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version