AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                              <-----
                                                                                       --------->GLK1(2)
                                                                                       --------->RVE1(2)
                                                                                       --------->GATA12
                                                                                       <---------ARR14(2)
                                                                                       --------->ARR14(2)
                                                                              <---------AHL25(3)
                                                                              --------->KAN1  ------
                                                                             <---------AHL25(2)
                                                                             <---------AHL25(3)
                                                                             --------->AHL25(3)
                                                                             --------->AHL25(2)
                                                                             --------->AHL20(2)
                                                                             <---------AHL20(1)
                                                                             <---------AHL25(1)
                                                                             --------->AHL12(1)
                                                                             <---------AHL12(1)
                                                                             --------->AHL20(1)
       <---------AtMYB61                                                     <---------AHL20(3)  <--
--------->MYB52(1)                                                           <---------AHL20(2)  <--
-------->ARR14(2)                                                            --------->AHL25(1)  <--
---------ARR11(2)                                                            --------->AHL20(3)  ---
---------ARR14(2)      ------->TEIL                                   ---------->DOF2  <---------GATA12
-->ANAC46 --------->ALFIN1                     <---------ICU4    <---------------AGL15--------->KAN1
 
aagaaacggagaggtcgagctatatgaatttataccaaaaacacctctaatttttgctagactcaatacccttcaaagaatttattccaaaatccgaatg  1128000
          --------->At4g35610
          <---------ZAT2             --------->AHL20(2)                                    <--------
          --------->ZAT2            <---------ATHB12                                    <---------ANAC58
----KAN1  <---------At4g35610 --------->ANAC46  <----------DOF2                         <---------ANAC58
----->HVH21 <----------DOF2  --------->SPL7(1)------->TEIL                       ------>MYB83
-------bZIP60(2)          --------->AtMYB61--------->ANAC58                      ------>MYB46(1)
-------ANAC58          <-----------GT1     --------->ANAC58                     --------->ANAC46
-------ANAC58        --------->RVE1(2)     --------->ANAC46                    --------->MYB46(3)
-------->RAV1(2)    <---------CCA1(2)---------->DOF2                           ------->GAMYB
 
acctgtccctctcagctttgcccatatcaccataccccaataaaacacgaactttagataccaaaaaacatagaaacaataacccaccatttcttgcgca  1128100
                                                     --------->GATA12
                                                     <---------GATA12
                                                     --------->ARR11(2)
                                                     --------->ARR14(2)
                                     --------->ARR11(3)        --------->YAB1     --------->GLK1(2)
                                  ------>NtERF2      <---------ARR11(2)           --------->ARR14(2)
                               --------->YAB5        <---------AGP1               <---------ARR14(2)
                               ------->GAMYB         <---------ARR14(2)           <---------GATA12
                         <---------ANAC58            <---------RVE1(2)   <---------DAG2
                         --------->ANAC55(2)   ----------->HVH21   --------->DAG2 --------->GATA12--
                    <---------AtLEC2 <---------ARR11(3)------>ZmHOX2a(2) <---------DOF5.7(1)     ---
            <--------P   <---------ANAC55(2) <---------ZAT2   <---------YAB1      --------->RVE1(2)
           <---------MYB52(1) --------->MYB46(3)   ------>ZmHOX2a(2)   ------->TEIL            <----
          <---------DEAR3(2)  --------->DEAR3(1) <XXXXXXXXXXXXXXXXXXXXMIR842      <---------ARR11(2)
        <---------LBD16  <---------ANAC58    <---------At4g35610   --------->DOF5.7(1)         -----
-LBD16--------->ANAC46   --------->ANAC46    --------->At4g35610  ---------->DOF2 --------->ARR11(2)
 
aggggattaacgccggtaagtttgcattgcgcaacgacgacatcttggagctgatcgatctggctatgaaaaagcaccttctgcgaatccaatagctcca  1128200
                                                         --------->ANAC58
                                                         --------->ANAC58
                                                        <------NtERF2
                                                        <---------------------WRI1
                                                       --------->MYB52(1)
                                                       ------>NtERF2
                                                       <---------ATERF1(1)
                                                      --------->At1g77200
                                                      --------->RAP2.3(3)
                                                      --------->DEAR3(1)
                                                      ----------->HVH21
                                                      --------->DREB2C(2)
                                                     <------NtERF2
                                                     --------->RRTF1(1)
                                                     --------->RAP2.3(1)
                                                     --------->ERF1
                                                     --------->ATERF1(1)
                                                     --------->ORA47(2)
                                                     --------->DEAR3(2)
            --------->At4g35610                     <---------ATERF1(1)
            --------->ZAT2                          ------>NtERF2
            <---------At4g35610                     <---------At4g35610
            <---------ZAT2                          --------->At4g35610       --------->ANAC58
         --------->DEAR3(1)                         <------NtERF2             <---------ANAC55(2)
        --------->ANAC46                           --------->ATERF1(2)        --------->ANAC58
      <---------ALFIN1                             <---------DEAR3(1)      --------->ARR11(2)
     <---------ZAT14                               <---------ATERF1(2)     <---------ARR11(2)
-------->DOF2                                      --------->RAP2.6(2)     --------->ARR14(2)
------>AHL20(2)                ------>ZmHOX2a(1)   --------->DEAR3(1)      <---------ARR14(2)
-----WOX13(2)       --------->GLK1(1)             <---------RAP2.6(2)    --------->AtMYB61
---->WOX13(2)    --------->LBD16 --------------------->WRI1   --------->KAN1  --------->ANAC46     <
 
ttaaagactccaccgagctcccgatttctatctcctccttgaacgcgtccatggccgccgacggaaaactcgaagaccaatacgcaaaccgaattcaaaa  1128300
                                                                                         -----------
                                                                                       --------->ARR14(2)
                                                                                       <---------RVE1(2)
                                                                                       <---------GLK1(2)
                                                                                       <---------ARR14(2)
                                                                                       --------->ARR11(2)
                                                                                --------->WOX13(2)
                                                                             <---------MYB46(2)
                                                                             <---------MYB59
                                                                 --------->YAB1------>MYB83
           <---------AHL25(1)                                   <---------ATHB12<---------WOX13(2)
           --------->AHL25(1)                        ----------->GT1        --------->ANAC55(2)  ---
          <---------KAN1  <------ZmHOX2a(1)          --------->YAB5         <-----------------AGL1
         <---------WOX13(2)       --------->YAB5    ----------->GT1------->TEIL------>MYB46(1)  ----
     --------->LBD16  --------->TOE1(2)     --------->ALFIN1   --------->WOX13(2)  <---------LBD16 -
   <-----------RAV1(2)--------->TOE2(2)   <---------KAN1--------->AHL20(2)  <---------ANAC55(2) ----
-------TEIL--------->AHL20(2)     --------->KAN1   <---------------------WRI1--------->TOE2(3) -----
 
tgtgcatcagggaattaaactgaaacgtaggactcagtgattcgaatgtgttgaaacgataaattcaatgaacatggttacctaatttcggattgtcaaa  1128400
                                                                                         <---------At4g35610
                                                                                <---------YAB1
                                                                                ----------->TBP
                                                                              --------->YAB1
   --------->GLK1(2)                                                        --------->AHL20(3)
  --------->ARR11(2)                                                        <---------AHL12(3)
  <---------ARR11(2)                                                        <---------AHL25(2)
  <---------ARR14(2)                                                        <---------AHL20(3)
  --------->ARR14(2)                                                        --------->AHL25(2)
  <---------GATA12                    --------->DOF5.7(1)                   <---------AHL12(2)
  --------->GATA12                   --------->DOF5.7(1)                  --------->AHL12(1)
  <---------GLK1(2)         ----------->GT1                               <---------AHL12(1)
>GT1     <--------P         --------->ANAC58                   <----------DOF2--------->AHL20(2)
------>DOF5.7(1)            --------->ANAC58     ----------->GT1    ---------->DOF2      <------NtERF2
----->DAG2  <---------TOE1(3)        --------->DAG2            <---------------AGL15 --------->ANAC58
---------------->AGL1  <---------TOE2(3)       ---------->DOF2 --------------->AGL15 --------->ANAC46
----->DOF5.7(1)     *TSS <------ZmHOX2a(1)   <---------KAN1 <-----------GT1--------->AHL12(2)     <-
----->DOF2  <---------TOE2(3)       ---------->DOF2--------->AHL20(2) ----------->GT1--------->ANAC58
 
aagccgattcgggttagggtttgagtaaggaaggcaaaataaaggggcataaaagtaaataagttactttacaaagaaaaattataaaacgcagcgtctt  1128500
                                                                                --------->GATA12
                                                                              <---------AHL25(3)
                                                                              <---------AHL20(2)
                                                                             <---------AHL25(1)
                                                                             --------->AHL20(3)
                                                                             <---------AHL20(3)
                                                                             <---------AHL25(3)
                                                                             --------->AHL12(3)
                                                                             <---------AHL20(2)
                                                                             --------->AHL25(1)
                                                                             --------->AHL25(3)
                                                                             --------->AHL20(2)
                                                                           <---------WOX13(2)
                                                                           <---------AHL12(2)
                                                                           --------->WOX13(2)
                                                                          <---------ICU4
                                       <---------YAB1                     --------->YAB5
                                       <---------AHL12(2)                 <---------AHL25(3)
                                      <---------AHL20(3)                 <---------ATHB51
                         --------->AHL12(3)                              --------->AHL12(1)
                         <---------AHL20(2)                              <---------AHL20(2)
                         <---------AHL20(1)                              --------->ICU4
                         --------->AHL20(2)                              --------->AHL12(3)
                         <---------AHL12(3)                              <---------AHL12(1)
                         --------->AHL20(1)                              <---------AHL25(1)
                         --------->AHL25(2)                              --------->AHL25(2)
                         --------->AHL25(1)                              --------->AHL25(3)
                         <---------AHL25(3)                              --------->AHL25(1)
                         --------->AHL25(3)                              <---------AHL12(3)
                         <---------AHL25(2)                              --------->AHL20(2)
                         <---------AHL25(1)      --------->AHL20(2)     --------->AHL12(2)
              ----------->GT1         --------->AHL20(3)                <---------AHL12(2)
             --------->DAG2           --------->AHL20(2)                --------->AHL25(2)
             --------->DOF5.7(1)      --------->AHL25(2)                --------->AHL25(3)
           ---------->DOF2<---------AHL12(2)     <---------AHL20(1)     <---------AHL12(3)
     ------>ZmHOX2a(2)  <---------AHL25(3)       --------->AHL20(1)     --------->AHL12(3)
    <---------GLK1(1)   --------->AHL25(3)       <---------AHL20(3)     --------->AHL20(3)
    <<<<<<<<<GATA-1     <---------AHL25(2)       <---------AHL20(2)     <---------AHL20(3)
    <<<<<<<<<GATA-3     <---------AHL12(1)       --------->AHL20(3)     <---------AHL25(2)
    <<<<<<<<<GATA-2     <---------AHL20(2)       --------->AHL25(1)    --------->YAB1
    <------ZmHOX2a(2)   --------->AHL20(2)       <---------AHL25(1)    --------->AHL12(2)
    <<<<<<<<<GATA-4     --------->AHL12(3)       <---------AHL25(2)  --------->AHL25(2)
   <---------ARR14(2)   --------->AHL12(1)       --------->AHL25(2)  <---------AHL12(3)
   <---------AGP1 --------->ANAC58    <---------AHL25(2)             <---------AHL20(3)
   --------->ARR14(2)   <---------AHL12(3)       --------->AHL12(1)  --------->AHL12(3)
   --------->GATA12     --------->AHL25(2)       <---------AHL12(1)  --------->AHL20(3)            -
   --------->ARR11(3)   <---------AHL25(1)       <---------ARR11(3)  --------->AHL20(2)          <--
   --------->RVE1(2)    --------->AHL25(1)       --------->ARR11(3) <---------AHL25(3)           <--
   <---------ARR11(3)  --------->AHL12(2)        --------->AHL25(3) --------->YAB1               ---
   <---------GATA12   <---------WOX13(2)         <---------AHL25(3)--------->AHL20(2)            ---
  <---------CCA1(2)   --------->WOX13(2)  <---------YAB1       --------->AHL20(2)                ---
--------REM1(1)   --------->ANAC58 --------->AHL12(2)  --------->WOX13(2)<---------AHL25(3) --------
 
gatgtagatctctgaaaaggtaagaaattaaatttgtttaatattatactaatatattagttgacataaaataaaaataattaaatctataagacctgaa  1128600
                                                 <---------DOF5.7(1)
                                                <---------DOF5.7(1)
                                              <---------ZAT18
                                             --------->DEAR3(1)
                                           <---------At5g28300
                                          <-----------GT1
                                      <----------DOF2
                                   <---------ARR11(3)
                                   --------->ARR11(3)
                                  <---------CCA1(1)
                                  <---------RVE1(1)
                                  --------->GLK1(1)
                                  <---------GLK1(1)
-------->YAB1                     --------->CCA1(1)                                              ---
-------AHL25(2)                   --------->RVE1(1)                                            <----
-------AHL20(3)                  <---------ARR11(3)                    <----------DOF2    <---------DOF5.7(1)
------>AHL25(2)                  --------->ARR11(3)  <---------YAB1   <---------DOF5.7(1)<---------DAG2
------>AHL20(2)              ------>ZmHOX2a(1)------>NtERF2      <---------CCA1(2)       <---------DOF5.7(1)
------>AHL20(3)              --------->LBD16--------->MYB46(3) <---------O2              <----------DOF2
--->GT1              *TSS  ----------->RAV1(2)--------->ABI4(1)--------->O2         <-----------GT1
 
aataatagaatagaagagaacgagtttgtttcctgagatatcttttcaccgcccttctcataggtctcgtctctctttctctctattttacgcttttttc  1128700
                                                                 <---------ARR11(2)
                                                                 --------->ARR11(2)
                                                                 <---------ARR14(2)
                                                        <-----------ARR10
                                                       <---------At4g35610
                                                       --------->ZAT2
                                                    <---------At4g35610
                                                    <---------ZAT2   ------>ZmHOX2a(1)
                                                    --------->ZAT2<------ZmHOX2a(2)
                                                    --------->At4g35610                     <-------
                                                ============================HOX2a_HOX2a    ---------
    --------->GLK1(2)                           ------>ZmHOX2a(2)--------->GATA12 --------->GLK1(2)
   <---------GLK1(2)                          --------->GATA12   --------->ARR14(2)       <---------YAB5
  --------->YAB5  <---------GLK1(2)           <---------GATA12   <---------GATA12 <---------ARR11(2)
--->ZmHOX2a(1)    <---------RVE1(2)    <----------DOF2 --------->At4g35610   <---------LBD16<-------
-----LBD16      <---------YAB1        <---------DOF5.7(1)      --------->DEAR3(1) <---------ARR14(2)
 
ctgaacgattcttagggttttgattctctctctctctcgcttctttttcgatcgcagcagctctcgccgatcctgtgtaatcgggaatcggtaatcgtca  1128800
                   ------>NtERF2
                  --------->ANAC58
                  --------->ANAC58
                 <------NtERF2
                 --------->ATERF1(1)
                <---------ATERF1(1)
                ------>NtERF2
               <---------DEAR3(1)              <------ZmHOX2a(2)
               --------->DEAR3(1)             <---------GATA12                   <---------TOE1(2)
               ----------->HVH21              <---------ARR11(3)                <---------ANAC58
            <---------DEAR3(1)       <---------TOE2(3)    --------->YAB5        <---------ANAC58
           <-------TEIL              <---------TOE1(3)    <-----------GT1<---------RVE1(2)
           --------->SPL7(1)      <---------YAB1          --------->ZAT6 --------->ARR11(2)
          --------->ALFIN1      <---------ICU4--------->ARR14(2)         --------->GATA12
        <---------ANAC58        --------->ATHB12------>ZmHOX2a(2)        <---------GLK1(2)
       <---------------AtSPL3  <---------YAB1 --------->ARR11(3)         --------->ARR14(2)      ---
       <---------------AtSPL8  --------->ICU4 --------->GATA12           <---------ARR14(2)     ----
   <---------MYB52(1)        --------->YAB5   <---------ARR14(3)         <---------ARR11(2)     ----
----TGA1<---------ANAC58<---------KAN1        <---------ARR14(2)      <---------ANAC46          ----
>YAB1 <---------ANAC46 <----------DOF2        <---------AGP1          --------->ETT(1)          ----
----HVH21<---------SPL7(1)  <---------YAB1    --------->ARR14(3)   <-----------RAV1(1)         -----
 
gggtctgtttggggtacggcgacgcgattttctgattattagggtttaagatctcgaggtatcactatttctgtcggattctcgcttgttttgttccata  1128900
<- Previous    Next ->

AGI:  At4g02560.1   
Description:  LD (LUMINIDEPENDENS); transcription factor. Identical to Homeobox protein LUMINIDEPENDENS (LD) [Arabidopsis Thaliana] (GB:Q58T20;GB:Q9C5Z9); similar to unnamed protein product [Vitis vinifera] (GB:CAO22394.1); contains InterPro domain Homeodomain-related; (InterPro:IPR012287); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Homeobox; (InterPro:IPR001356)
Range:  from: 1123490    to: 1128421    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g02570.1   
Description:  ATCUL1 (CULLIN 1). Identical to Cullin-1 (CUL1) [Arabidopsis Thaliana] (GB:Q94AH6;GB:O22770;GB:Q56W31); similar to CUL2 (cullin 2), ubiquitin protein ligase binding [Arabidopsis thaliana] (TAIR:AT1G02980.1); similar to cullin-like protein1 [Pisum sativum] (GB:BAC10548.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO70971.1); similar to cullin 1-like protein C [Petunia inflata] (GB:ABB77428.1); contains InterPro domain Winged helix repressor DNA-binding (InterPro:IPR011991); contains InterPro domain Cullin homology; (InterPro:IPR016158); contains InterPro domain Cullin repeat-like (InterPro:IPR016159); contains InterPro domain C
Range:  from: 1128622    to: 1133696    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version