AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                   --------->YAB1                         --------------->AtSPL8            --------
                 <---------AHL12(2)                       <---------------AtSPL8            <-------
            --------->YAB1                            --------->AHL12(1)                    --------
          --------->AtLEC2                            <---------AHL12(1)                    --------
        --------->YAB1                                <---------AHL20(2)                    <-------
        <---------ICU4                                --------->AHL25(1)                    <-------
       <---------ATHB12        --------->TOE2(3)      --------->AHL12(3)                   ---------
       <---------YAB5          --------->TOE1(3)      --------->AHL20(2)                   <--------
     --------->YAB1--------->AHL20(2)                 <---------AHL12(3)                   ---------
    --------->AHL12(1)   --------->YAB1               <---------AHL25(1)                   ---------
    <---------AHL12(1)---------->DOF2            <---------AHL20(2)                 ---------->DOF2
 --------->YAB5 --------->AHL12(2)              --------->AHL20(2)     <----------DOF2<---------TOE2(3)
---MYB.PH3(2)  --------->AHL20(2)  <-----------GT1    --------->AHL25(3)           <---------AHL20(2)
 
aaaatgaataatcatgcataaattataaagataacattaaaccattttccattttatataatttgtacaaataacttttaagttatataaaggaattatt  19843100
    <---------YAB1
  --------->KAN1
--AHL25(3)                                                                                       <--
->ATHB51                                                <---------DAG2                           <--
--AHL25(1)                                       <---------HSFC1(1)                              <--
->AHL25(1)                                       <---------HSFB2a(2)                             ---
--AHL20(2)                                       --------->HSFC1(1)                              <--
->AHL20(2)                                  <---------ARR11(3)                                   ---
->AHL12(1)                                  --------->ARR11(3)                                   <--
--AHL12(1)                                 <---------CCA1(2)                                   -----
--AHL12(3)                               <---------AHL12(2)        ---------->DOF2             -----
>AHL25(3)     <---------WOX13(2)        <---------AHL20(2)      <---------------AGL15      <--------
-YAB5 <---------ANAC58                 --------->AHL20(2)       --------------->AGL15<---------RVE1(2)
>AHL12(1)<---------------ANT          <---------YAB1    <----------DOF2   --------->GLK1(1)---------
>ICU4 <---------ANAC58             <---------YAB1--------->HSFB2a(2) --------->DOF5.7(1) <----------
 
tagaaatatgcttgggtaattgtgttctcttctaatttcttattatatatctctagaaactttttttctcaaaagagatttctaaactgatattacatat  19843200
                                                                                  <---------YAB1
                                                                                --------->YAB5
                                                                                <---------ICU4
                                                                                --------->YAB1
                                                                                <--------HAHB4
                                                                               <---------YAB5
                                                                               <---------YAB1
                                                                           --------->WOX13(2)
                                                                         <---------AHL20(2)
                                                                      --------->AHL12(1)
                                                                      --------->AHL25(2)
                                                                      <---------AHL25(3)
                                                                      <---------AHL12(1)
                                                                     <---------AHL12(1)
                                                                     <---------AHL25(1)
                                                                     --------->AHL25(1)
                                                                     --------->AHL12(1)
-------AHL20(3)                                                      --------->AHL12(3)
-------AHL12(3)                                                      <---------AHL20(2)
-------AHL25(1)                                                      <---------ICU4
------>AHL12(3)                                                     --------->AHL25(3)
-------AHL25(2)                                                    --------->AHL12(2)
------>AHL20(3)                                                    <---------AHL12(2)
-------AHL20(2)                                                   <---------AHL20(2)
---->AHL12(2)                                                    --------->AHL20(2)    <---------AHL20(2)
---->AHL12(3)             <---------WOX13(2)                     --------->AHL25(1)   --------->AHL20(2)
-ANAC55(2)           ----------->GT1                             --------->AHL25(3)--------->YAB1  -
>ANAC55(2)     <-----------RAV1(1)                            ----------->GT1<---------ICU4---------
-GT1      --------->AHL12(2)                                  --------->YAB5--------->ICU4 ---------
 
tttttttttagtttttttttgttgttgtaaattttagacatctatttttagacatctatattaaacgattaaatatttcattatcattataaaatcataa  19843300
                                                                             <---------ARR11(3)
                                                                          --------->AHL20(3)
                                                                          --------->AHL20(2)
                                                                          <---------AHL20(3)
                                                                          --------->AHL25(1)
                                                                          <---------AHL20(2)
                                                                          <---------AHL25(2)
                                                                          <---------AHL25(3)
                                                                          --------->AHL25(2)
                                                                          <---------AHL25(1)
                                                                       <---------AHL12(2)
                                                                       <---------WOX13(2)
                                                   <-----------GT1    <---------AHL20(2)
                                            --------->AHL20(3)        <---------AHL25(3)
                                            <---------AHL12(3)       <---------AHL25(1)
                                            <---------AHL20(2)       --------->AHL25(1)
                                            --------->AHL25(1)       <---------AHL12(3)
                                            --------->AHL20(2)       --------->AHL12(3)
                      --------->AHL20(1)    --------->AHL25(3)       <---------AHL12(1)
            --------->AHL12(1)              --------->AHL25(2)       <---------AHL20(2)
          --------->AHL12(3)             --------->AHL20(3)          --------->AHL20(2)
          --------->AHL20(3)             --------->AHL25(2)          --------->AHL25(2)
          <---------AHL20(2)             <---------AHL25(2)          --------->AHL12(1)
          <---------AHL12(3)             --------->AHL12(1)          <---------AHL25(3)
          <---------AHL20(3) <---------DAG2 <---------AHL25(1)       --------->AHL25(3)
------>TEIL <---------AHL12(1)           <---------AHL12(1)        <---------WOX13(2)      ---------
>YAB1     <---------AHL25(2) <----------DOF2<---------AHL20(3)     --------->WOX13(2)  <---------KAN1
>YAB5    --------->YAB1<-----------GT1   <---------AHL20(3)<---------MYB52(1)--------->ARR11(3)  ---
 
tgtatttatgtataaaaattcaaaatatactactttttgtttaaaattttaatattacttctgtttggcaaattaaataaaatctttcgaatagttgaca  19843400
                                                                                          --------->ANAC55(2)
                                                   ------>ZmHOX2a(2)                      <---------ANAC55(2)
                                                   ==========================HOX2a_HOX2a  --------->ANAC46
                                                   =============================HOX2a_HOX2a   ------
                                                 --------->ARR11(2)                  <---------ICU4
                                                 <---------ARR14(2)                  --------->YAB5
               <---------AHL20(2)                --------->GLK1(2)                  <---------ATHB12
               ----------->TBP                   --------->ARR14(2)                 <---------KAN1
               --------->AHL12(3)                *TSS         <----------DOF2      --------->RVE1(2)
               --------->AHL25(1)    <---------WRKY12     ---------->ID1        --------->ANAC46
               --------->AHL20(2)    <---------WRKY38(1)--------->MYB52(2)   --------->ARR11(2)
               <---------AHL12(3)    <---------WRKY45   --------->KAN1       <---------ARR14(2)
               <---------AHL25(1)   --------->WRKY18(1) <---------MYB46(3)   <---------ARR11(2)
    <---------WOX13(2)             <-----------HVH21  <---------MYB52(1)     --------->ARR14(2)
    --------->WOX13(2)       ---------->DOF2     <---------ARR11(2)       --------->TOE2(1)   <-----
  --------->AHL20(2)      >>>>>>>>>MYB2          <---------GATA12         --------->TOE1(1)   <-----
-->HVH21      --------->AHL12(2)   <--------ZAP1 --------->GATA12        ------>ZmHOX2a(1)--------->ANAC58
-------->GT1 <---------KAN1 --------->AtMYB61   <------ZmHOX2a(1)     ------>ZmHOX2a(1)   --------->ANAC58
 
tagtataaattagagaatataaataagaaaaccaaagcggtcaacacaagaggatcggtttgttcctttcttcctcctcgtatacgaatcaatacgcatt  19843500
                                       <---------ALFIN1
                                    <---------ALFIN1
                                  ------->GAMYB==================================HOX2a_HOX2a
                                 --------->MYB46(3)
                               ======================RAV
                            <------ZmHOX2a(2)  ------>ZmHOX2a(2)
                            --------->CCA1(2) --------->At4g35610
                            ======================HOX2a_HOX2a
                           --------->AGP1----------->RAV1(2)
                           <---------ARR11(3)--------->ARR14(2)
                           --------->RVE1(2) <---------ARR14(2)                               ------
                           <---------ARR11(2)<---------ARR11(3)                               ------
                           --------->GATA12  --------->ARR11(2)                         --------->TOE2(3)
                           --------->ARR11(2)<---------RVE1(2)                   --------->YAB1
                           <---------ARR14(2)<---------ARR11(2)               --------->WOX13(1)  >>
                           <---------GATA12  --------->GATA12              <-----------HVH21 <------
--->GLK1(1)                --------->ARR14(2)<---------GATA12             ------>ZmHOX2a(1) --------
----KAN1 --------->RVE1(2)--------->GLK1(1)------>ZmHOX2a(1)            ----------->RAV1(2) <-------
----CCA1(2)   ---------->DOF2  ----------->RAV1(1)                 <---------GLK1(2)<---------GLK1(1)
 
tctccaactccatagccaaaagctcgacgagatccaacagcacctcctgatctgcatcgttttcaacttagcttctcctgtcaatcgaaatccctaatta  19843600
                                                                       <---------KAN1
                                                                       --------->KAN1
                                                                       <---------GLK1(1)
                                                                       --------->GLK1(1)
                                                                      <---------RVE1(2)
        <---------GATA12                                    <---------At4g35610
        --------->ARR14(2)                               <---------MYB52(1)
        <---------ARR11(2)                              <-----------TGA1
        <---------ARR14(2)                              <-----------HVH21
     ------>ZmHOX2a(2)                                 <---------ANAC55(2)
  --------->ATHB12                                     <---------ANAC58<----------TaMYB80
--->YAB1--------->GATA12                 <-----------HVH21  --------->At4g35610
--->AHL20(2)                            <---------bZIP60(1) <---------ZAT2  <---------LBD16
>>>>>>>EIN3                      --------->GLK1(2)     <---------ANAC58<---------HSFB2a(1)
---YAB5 --------->ARR11(2)      <---------GLK1(2) --------->KAN1      --------->GATA12
->WOX13(2)               <---------HSFB2a(2)--------->WOX13(1)<----------DOF2        ------>ZmHOX2a(1)
--WOX13(2)    <---------ATHB12 --------->KAN1<---------GATA12<---------GLK1(2)  <---------ARR11(2)
 
tacattgatcggattcaatcgagcgattcgagagagaatcgcgatgtcaatccaaattccgtcagcttcttgggattttcgcggtttcctactctgtttc  19843700
                                                                                                 ---
                                                                                                 <--
                                                                                                <---
                                                                                                ----
                                                                                                <---
                                                                                          <-------PIF5
                                                                                          ------->PIF5
                                                                                          <-------MYC2
                        --------->RVE1(2)       <---------RVE1(2)                         ------->MYC2
                 ----------->GT1              <---------YAB5                              ------->MYC3
               <-----------RAV1(2)        <---------KAN1                          <-----------RAV1(1)
      <---------ZAT2   <---------ICU4   <------ZmHOX2a(1)      <-----------------AG    <---------ANAC58
      <---------At4g35610       --------->GLK1(1)              <-----------------AGL1  <---------ANAC46
      --------->At4g35610       <---------GLK1(1)              ----------------->AGL1  <---------ANAC58
      --------->ZAT2  --------->ICU4  <---------TOE2(3)  <-------TEIL    ---------->DOF2  <-------MYC3
 
atcttcttcagctcgttaccaggtaaatatcacagaattctgaggatgagtgattttagtttcattttcgaattgggaaagtgttttgttgctcgtgcaa  19843800
                                                                                   --------->GATA12
                                                                                   --------->ARR14(2)
                                                                                   <---------GLK1(2)
                                                                                   --------->ARR11(3)
                                                                                   <---------RVE1(2)
                                                                                   <---------GATA12
                                                                                   <---------ARR14(2)
                  <---------ARR14(2)                                               <---------ARR11(3)
                  --------->ARR14(2)                                      <-------TEIL
       --------->ATHB12                                                  --------->ARR14(1)
       <---------ICU4--------->ATHB12                                   --------->GATA12
      <---------YAB5<-------TEIL                                        --------->ARR11(1)
      <---------YAB1<---------YAB5                                      <---------GLK1(2)
     <---------ARR11(3)                                                 --------->ARR14(2)
     --------->ARR11(3)                          --------->YAB1         <---------ARR14(2)
    --------->YAB5<---------ARR11(2)      <------ZmHOX2a(1)             <---------GATA12  --------->ANAC46
------>YAB1       --------->ARR11(2) --------->MYB52(1)                 <---------RVE1(2) --------->ANAC58
------ATHB1>>>>>>>>>WRKY18       ------>ZmHOX2a(2)                 --------->TOE2(3)      --------->ANAC58
------ATHB12     =======================HOX2a_HOX2a              <-------TEIL    ----------->ARR10--
----->ICU4----------->HVH21      ================HOX2a_HOX2a ----------->GT1   <-------TEIL      <--
------ATHB51     <------ZmHOX2a(1)  ----------->HVH21 --------->ZAT6  ----------->ARR10 <-----------GT1
 
taatagatgatcattgacgaggattcattgttttgatccctaacaggaacaatactaacacaagaagttacattagattcggttcagattttcacgactc  19843900
                                                                  <---------ANAC46           <------
       --------->HSFB2a(2)                                   <---------ANAC46               <-------
       <---------HSFB2a(2)                                   <---------ANAC58           <-----------GT1
  <---------MYB46(3)     <----------DOF2                     <---------ANAC58         <---------ANAC58
  <------MYB46(1)       <---------DOF5.7(1)             --------->ALFIN1          --------->YAB5
  <------MYB83     --------->ZAT14     --------->DOF5.7(1)   ----------------->AGL1   <---------ANAC58
------->ATHB12     <---------ZAT14   ---------->DOF2    <-----------RAV1(1)      <---------ATHB12
-------YAB1 <---------KAN1<---------DOF5.7(1)        <---------DEAR3(1)      --------->MYB46(3)
 
acgattggttctcgactaagcctacagtctttttccaatgcaaaggagagaacaagacggtgttgcctgatgtgaagagaaccaatgtttcttactcttt  19844000
<- Previous    Next ->

AGI:  At3g53490.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G02720.1); similar to Os03g0282800 [Oryza sativa (japonica cultivar-group)] (GB:NP_001049748.1); similar to hypothetical protein [Oryza sativa (japonica cultivar-group)] (GB:AAN64501.1); similar to hypothetical protein OsI_010747 [Oryza sativa (indica cultivar-group)] (GB:EAY89514.1); contains domain Pili subunits (SSF54523)
Range:  from: 19843450    to: 19845051    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version