AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                               <----------DOF2
                                            --------->GLK1(2)
                                           <---------GLK1(2)
                                          --------->YAB5
                                        <-------TEIL
                                       --------->ARR14(1)
                    <---------DOF5.7(1)--------->CCA1(2)
              --------->YAB1          --------->ARR11(1)
             <---------ATHB12         <---------RVE1(2)                         <-----------RAV1(1)
            ------>MYB83              --------->ARR14(2)                       <---------YAB1
            ------>MYB46(1)           <---------ARR14(2)                   <----------DOF2
       <-----------GT1                <---------ARR11(2)                   --------->TOE2(3)      --
---------DOF2--------->MYB46(3)       --------->ARR11(2)                   <---------DAG2         ==
-------DOF5.7(1)    --------->YAB1   --------->CCA1(2)               <---------DOF5.7(1)      ------
>GLK1(2)   --------->WOX13(1)   --------->DOF5.7(1)  <------ZmHOX2a(1)<----------DOF2         ------
 
tcttttgttttcaccaatcaccatcttaacttgagaagagagatacgattcttttaggagttttagtcttcgtctttgccttattgttgctcaataacct  8672400
                       <---------TGA1a
                       --------->O2
                       --------->TGA1a
                       <---------O2
                    <---------ZAT14
                    --------->ZAT18        --------->ANAC58
     <-----------GT1<---------ZAT18   --------->ANAC46                                        <-----
-------->DOF2     <---------ZAT18   <---------ANAC55(2)                     --------->ATHB12  <-----
=================================bZIP_DOF  --------->ANAC58                <---------YAB5 <---------
--->TOE2(3)       --------->ZAT14   --------->ANAC55(2)             ------>ZmHOX2a(1)   <---------YAB1
--->TOE1(3)       <---------ZAT14 <-----------GT1            <---------AHL12(2)         <---------YAB5
 
caaaagttttacaataaacagagcacacttggcaatgttacgagacacactattagcatcaacaaattttcctaaggcatcatttgtgtttgtcattgct  8672500
                                                      --------->AHL12(3)
                                                      ----------->TBP
                                                      <---------AHL20(2)
                                                      --------->AHL20(2)
                                                      <---------AHL12(3)
                                                    ----------->TBP
                                                  --------->AHL20(3)
                              ------>MYB83        <---------AHL12(3)
                              ------>MYB46(1)     <-----------TBP
                            --------->DEAR3(1)    --------->AHL20(2)
                           --------->DEAR3(2)     <---------AHL20(2)
      --------->GATA12     --------->MYB46(3)     --------->AHL12(3)
   ===========================RAV                 <---------AHL20(3)                   <---------GATA12
   <-----------RAV1(2)   <-----------GT1          --------->AHL25(1)                   --------->GATA12
 <-----------HVH21   --------->YAB1               <---------AHL25(1)        --------->WOX13(2)   <--
----ANAC58         ------------>CBF             <-----------TBP        <---------YAB5  --------->ARR11(3)
----ANAC58        ----------->RAV1(1)     <---------At5g28300       <-------TEIL       <---------ARR11(3)
---CBF<---------GATA12  ---------->DOF2  <-----------GT1    --------->ANAC46<---------WOX13(2)   ---
 
tctggttcaggtctggtactccaacaataaaccgacccttcaaattacagtatttatatatatacccaagtttcatcgtagttaaaccaagatttagcaa  8672600
                                                                                  ----------->GT1
                                                                                  --------->LBD16
                                                                                 <---------ANAC46
                                                                                <---------LBD16
                                                                            --------->KAN1 >>>>>>>>>EIN3
                                                                           <---------AHL25(3)
                                                                           <---------AHL12(1)
                                                                           <---------AHL20(1)
                                                                           --------->AHL12(1)
                                                                           <---------ARR11(3)
                                                                           --------->ARR11(3)
                                                                           --------->AHL20(1)
                                                                           --------->AHL20(2)
                                                                           <---------AHL25(1)
                                                                           --------->AHL25(2)
           --------->MYB52(1)                                              <---------AHL25(2)
         <---------MYB52(2)                                                --------->AHL25(3)
       --------->YAB5                                                      --------->AHL25(1)
      <---------MYB55(2)                                                   <---------AHL20(3)
      --------->MYB46(3)                              <---------At5g28300  <---------AHL20(2)
     -------->P                              --------->RVE1(2)             --------->AHL20(3)
 --------->ANAC46             --------->MYB52(1)   <---------WOX13(2)     --------->AHL12(2)
 --------->ANAC58            --------->DOF5.7(1)   --------->WOX13(2)     <---------AHL12(3)
 --------->ANAC58     ------->TEIL     --------->TOE2(3)                  --------->AHL25(1)
-------WOX13(2)       ----------->RAV1(1)    <---------GATA12             --------->AHL12(3)<-------
------>WOX13(2)     --------->ZAT18   <----------ID1 <-----------GT1 ----------->GT1      <-------TEIL
 
aattaagcaaccactaactgaaatgcaccaaaaaaacgaaaaccacaaaatccaaattaccatgaaatcgaactgaaatatattccggttatatacattg  8672700
                                                                                                 ---
                                                                                                 <--
                                                                                                 ---
                                                                                             ------>NtERF2
                                                                                            --------
                                                     <----------DOF2   <---------ETT(2) --------->ARR14(2)
                                                   <---------KAN1      --------->WRKY38(1) <--------
                ------>MYB46(1)             <---------MYB52(1)         --------->ETT(2) <---------ARR14(2)
                ------>MYB83             <---------LBD16            --------->ALFIN1    --------->ARR11(2)
              <---------MYB59         <---------At4g35610<---------RVE1(2)              <---------ARR11(2)
         --------->ARR11(3)    --------->ICU4<---------MYB52(1)     <---------KAN1   <---------ANAC58
 --------->MYB52(1)            <---------YAB1<--------P  <---------TOE2(3)           <---------ANAC46
-----CBF <---------ARR11(3)  --------->YAB1--------->LBD16<-----------RAV1(1)        <---------ANAC58
 
acacaaaccgaagataaccaaactattttcagttataattcatctccggttagcatctttgatgttgtcgagtgtcgaccatggcattgcgtttcccgcc  8672800
                                                      --------->At4g35610
                                                      <---------At4g35610
                                                     --------->ARR14(2)
                                                     <---------ARR14(2)
                                                     <---------ARR11(2)
                                                     --------->ARR11(2)
                                                    <---------CCA1(2)
                                                   <---------MYB52(1)
                                               ------>NtERF2                --------->YAB5
                                              <---------ALFIN1             <---------KAN1
                                             <------NtERF2                --------->ARR14(2)
                                             <---------ABI4(2)            <---------ARR14(2)
           <---------At4g35610              <---------ATERF1(1)           --------->GLK1(2)        -
           --------->ZAT2    <------NtERF2  --------->LBD16               <---------ARR11(1)     <--
    ------>ZmHOX2a(1)        --------->At4g35610<------NtERF2     --------->LBD16                ---
------>O2  ----------->RAV1(2)              ------>NtERF2     --------->GLK1(2)                  <--
-------O2  --------->At4g35610              <-----------HVH21<---------ARR14(2)                 ----
------>TGA1a               <---------ANAC46--------->LBD16   --------->ARR14(2)                <----
->ANAC46   <---------ZAT2 <------NtERF2    --------->ANAC46  <---------GLK1(2)       <-----------GT1
-LBD16   <-----------RAV1(2)------>NtERF2 <---------LBD16   --------->KAN1------->TEIL     ---------
 
tcgtctcctctctcagctgaagctatctcggcgtctgaattctctcccggcaccggtatctgaagattccgaagacgaatctttaaaattcccatccaat  8672900
                                                                         <---------ZAT2
                                                                         <---------At4g35610
                                                                         --------->ZAT2
                                   ----------->GT1                       --------->At4g35610
                                 <---------ZAT18   <---------ARR11(2)--------->ANAC58
                                 --------->ZAT18<------NtERF2        --------->ANAC58
                        --------->ARR11(3)     --------->LBD16     <---------ALFIN1
----->ZmHOX2a(2)        <---------ARR11(3)     ------>NtERF2    --------->REM1(1)
-------RVE1(2)         --------->YAB1         --------->ANAC46  --------->ANAC46
------>ARR11(3)       <---------ATHB12  --------->KAN1        --------->HSFB2a(2)
-------ARR11(3)       <---------YAB5    <----------TaMYB80    <---------HSFB2a(2)
----->YAB1            --------->ICU4<-------GAMYB  --------->ARR11(2)--------->ANAC46       <-------
-----ATHB12  --------->YAB5     ------------>AtMYB77       --------->ARR11(2)         --------->ZAT14
>MYB46(3)   <---------KAN1------>ZmHOX2a(2)  <---------LBD16  <-----------GT1     <---------------AtSPL8
 
gatcttcttctccgaacgagtagcaatgatctcgagggcagttatattcccgccgatagacgtttctacaacacgctgctgaagaaatgtacagtcttta  8673000
                               <---------ARR14(2)
                               --------->ARR11(2)
                               --------->ARR14(2)
                      --------->KAN1
                  ========================HOX2a_HOX2a
                  ------>ZmHOX2a(2)
                <---------ARR14(2)
                --------->ARR14(2)
                <---------ARR11(3)
                --------->ARR11(3)
               <------ZmHOX2a(1)
              <---------HSFB2a(1)
              --------->HSFB2a(1)  ------>ZmHOX2a(1)
              <---------HSFC1(2)  --------->TOE2(3)
              --------->HSFC1(2)  --------->TOE1(3)
  <---------------AGL15        --------->RVE1(2)              <---------YAB1                      <-
  ==================================================================================================
  --------------->AGL15        <---------ARR11(2)     ----------->HVH21              --------->RVE1(2)
 <-----------------AGL2       --------->GLK1(1)     <---------ICU4          <---------DOF5.7(1)-----
 <-----------------AGL1       --------->KAN1 <---------DOF5.7(1)        <---------ALFIN1     <------
---DOF2 <---------LBD16       <---------CCA1(2)   <-----------TGA1    ----------->RAV1(1)------->TEIL
 
agttgctcattcagggaaggatcgttcatgctcatatccttcaatctatctttcgtcatgacattgttatgggcaacactcttctcaatatgtatgctaa  8673100
                                                          <---------ANAC58
                                                          <---------ANAC46
                                                          <---------ANAC58
                                                  --------->GLK1(2)
                                                 <---------ARR11(3)                          -------
--------->LBD16       --------->DAG2             <---------GLK1(2)                          <-------
--------LBD16  <---------At4g35610               --------->ARR11(3)              --------->KAN1 ----
=========MADS_MADS   ---------->DOF2             <---------RVE1(2)       <---------GLK1(1)  <-------
---->KAN1   <------ZmHOX2a(1)                   <---------RVE1(1)   <----------DOF2  --------->ANAC46
---------AGL15 <---------ZAT2     --------->DOF5.7(1)    --------->MYB52(2)     --------->ARR11(2)
 
atgcggaagtttggaggaagctcgtaaagtgttcgaaaaaatgcctcagagagattttgttacttggactactttgatttctggttactcgcagcatgat  8673200
                                                                                            <-------
                                      --------->CCA1(2)                                     <-------
                                     <---------RVE1(2)                                      --------
                                     <---------GATA12                                       --------
                                     --------->GATA12                                     <---------
                      <---------AHL20(2)                                              --------->At4g35610
                <---------DOF5.7(1)----------->ARR10            <----------DOF2       --------->ZAT2
               <----------DOF2     <---------TOE2(3)        --------->ZAT14           <---------At4g35610
-->ATHB12  <---------MYB52(1)--------->GATA12               <---------ZAT18        <---------ZAT2
--KAN1   <---------ANAC58    <---------RVE1(2)              <---------ZAT14        <---------At4g35610
-->ZmHOX2a(2)  <---------DAG2--------->ARR11(3)        <---------ATHB12  <---------ZAT6  <---------At4g35610
--YAB1   <---------ANAC58<---------YAB5    <---------RVE1(2)--------->ZAT18     ---------->DOF2
 
cgaccttgtgatgcgttacttttttttaatcagatgttgagatttggatatagtcccaatgagttcactttgtctagtgtgatcaaagctgctgcagctg  8673300
<- Previous    Next ->

AGI:  At3g23990.1   
Description:  HSP60 (Heat shock protein 60); ATP binding / protein binding / unfolded protein binding. Identical to Chaperonin CPN60, mitochondrial precursor (CPN60) [Arabidopsis Thaliana] (GB:P29197;GB:Q9LIQ8); similar to chaperonin, putative [Arabidopsis thaliana] (TAIR:AT3G13860.1); similar to chaperonin, putative [Arabidopsis thaliana] (TAIR:AT2G33210.1); similar to GroEL-like chaperone, ATPase [Medicago truncatula] (GB:ABE86688.1); similar to Chaperonin CPN60-2, mitochondrial precursor (HSP60-2) (GB:Q05046); similar to Chaperonin CPN60-1, mitochondrial precursor (HSP60-1) (GB:Q05045); contains InterPro domain Chaperonin Cpn60; (InterPro:IPR001844); c
Range:  from: 8668925    to: 8672585    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At3g24000.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT3G23330.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO23685.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN70212.1); similar to pentatricopeptide, putative [Oryza sativa (japonica cultivar-group)] (GB:ABB47711.2); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 8672781    to: 8674682    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version