AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                          --------->AHL20(1)
                                                                          <---------AHL12(3)
                                                                          <---------AHL20(2)
                                                                          --------->AHL20(2)
                                                                          <---------AHL20(1)
                                                                          <---------AHL25(3)
                                                   ------->PIF5           --------->AHL12(3)
                                                   ------->PIF4           --------->AHL25(2)
                                                   <-------MYC4           --------->AHL25(1)
                                                   ------->MYC4           --------->AHL25(3)
                                                   <-------PIF5           <---------AHL25(2)
                                                   ------->MYC2           <---------AHL25(1)
                                                   <-------MYC3          --------->AHL20(2)
                                                   ------->MYC3          --------->AHL12(3)
                                                   <-------MYC2          <---------AHL20(2)
                                                   <-------PIF4          --------->AHL20(3)
                                                  <---------O2           <---------AHL12(3)
                                                  ============================bZIP_DOF
                                                  --------->ANAC58       <---------AHL20(3)
                                                  <---------ANAC55(2)    --------->AHL25(3)
                                                  ==============================================bZIP_DOF
                                                  ==========================================bZIP_DOF
                                                  --------->TGA1a        <---------AHL25(2)
           ---------->DOF2                        --------->ANAC58       <---------AHL25(1)
        *TSS                                      <---------TGA1a      --------->WOX13(2)
        ------>NtERF2                            <---------TOE1(2)   --------->AHL20(2)
       <---------ATERF1(2)                  ------->TEIL           <----------DOF2
       --------->ATERF1(2)                <-------TEIL      --------->ZAT14
      --------->RAP2.6(3)                --------->ANAC58   <---------ZAT14   <-----------GT1
     --------->MYB52(1)                  --------->ANAC58 --------------->AtSPL8     <----------DOF2
    ----------->HVH21                   ------->MYC3    --------->ZAT6 <---------WOX13(2)
----->LBD16=================================================bZIP_DOF --------->AHL25(3)
----At4g35610                           <-------MYC3   <---------ZAT14<------------------------ANAC81
--->At4g35610--------->DOF5.7(1)  --------->ANAC46--------->O2  <---------ALFIN1 <----------DOF2
----LBD16<------NtERF2     --------->AHL12(2)   <------------OsbHLH66<---------AHL20(2)
 
ggaagaattgacggcaaagaaggcaaacttattttttaagtcacatgcatcgcacgtgaacactgtaccactttaattttatttctttctttttctgtta  7445400
                                           <---------AHL20(2)
                                         --------->WOX13(2)
                                       <---------YAB1
                                       --------->ICU4
                                      <---------AHL20(2)
                                      --------->AHL20(2)
                                      --------->AHL12(3)
                                      --------->AHL20(1)
                                      <---------AHL20(1)
                                      <---------AHL20(3)
                                      <---------AHL12(2)
                                      <---------AHL12(3)
                                      --------->AHL12(2)
                                      <---------AHL25(2)
                                      --------->AHL20(3)
                                      --------->AHL25(2)
                           --------->AHL12(3)
                           --------->AHL20(2)
                           <---------AHL20(2)
                           <---------AHL12(3)
                           --------->AHL20(3)
                           <---------AHL25(3)
                           --------->AHL25(2)
                           --------->AHL25(1)
                           <---------AHL20(3)
                          --------->AHL20(2)
                          <---------AHL20(1)
                          --------->AHL25(2)
                          <---------AHL12(1)
                          --------->AHL12(3)
                          --------->AHL25(1)
                          <---------AHL25(1)
                          --------->AHL12(1)
             --------->AHL12(2)      --------->YAB1
        ----------->GT1   --------->AHL25(3)
      ---------->DOF2     <---------AHL25(3)                                            --------->TOE2(3)
   ----------->TBP        <---------AHL20(2)      <---------TOE2(3)               --------->ANAC58
 <---------------AGL15    <---------AHL25(2)  <----------DOF2 <-----------GT1     --------->ANAC58
 --------->TOE2(3)      --------->AHL12(2) <-----------GT1 <---------DOF5.7(1)  ---------->DOF2
 --------->TOE1(3)    --------->AHL20(2)--------->YAB1    <----------DOF2 --------->ATHB12
 --------------->AGL15<---------AHL20(2)--------->YAB5  ---------->ID1   <---------YAB1 <----------DOF2
 <----------DOF2      --------->AHL25(3)<---------ICU4 <-----------GT1   <---------AHL20(2)
 
aaaactttaaaaagaaaattagtttttaatttttttagaattataattactttaagtttttcttttttcaattgtttttattggaaagaaactttaatct  7445500
                              ------>MYB46(1)
                              ------>MYB83
                             --------->MYB55(1)
                            <---------MYB111(1)
                            <---------MYB59
                            <---------MYB46(2)
                           --------->ANAC55(2)
                      <---------AHL25(3)
                      <---------AHL20(2)
                     --------->AHL25(3)
                     --------->AHL20(2)
                  <---------AHL12(1)
                 <---------AHL20(1)
                 --------->AHL12(1)
                 --------->AHL20(3)
                 --------->AHL25(2)
                 <---------AHL25(2)                                                  <---------YAB1
                 <---------AHL12(1)                                                 <---------AHL25(2)
                 --------->AHL25(3)                                                 --------->AHL25(2)
                 <---------AHL20(3)                                                 <---------AHL20(2)
                 --------->AHL20(1)                                                 --------->AHL20(3)
                <---------AHL12(3)                            ------>ZmHOX2a(2)     <---------AHL25(1)
                <---------AHL25(2)                           <------ZmHOX2a(2)      <---------AHL20(3)
                --------->AHL12(3)                   --------->GATA12               --------->AHL20(2)
                --------->AHL12(2)      <---------AHL20(2)  <---------ARR11(3)     --------->YAB1
            --------------->AGL15       <---------AHL25(3)  --------->GATA12      <---------YAB1
            --------->HSFB2a(2)      ------>MYB83    --------->RVE1(2)         --------->ARR11(3)
            <---------------AGL15    ------>MYB46(1) <---------GATA12          <---------ARR11(3)
            <---------HSFB2a(2) --------->ZAT6       --------->ARR14(2) --------->YAB1
        <----------DOF2    <---------ANAC55(2) --------->RVE1(2)        <---------DOF5.7(1)
     <-----------GT1<---------AHL12(2) --------->AHL20(3)   <---------GATA12 <---------YAB5
 <---------AHL20(2) --------->AHL12(2) --------->AHL20(2)   --------->ARR11(3)--------->YAB1
 
gtattttcttactttctaaaaatattaaatacctaacaccaaatttatagtatctaaatccacgatcttaaacactcttaatgatattataatccaattc  7445600
                                                                                                <---
                                                                                       --------->HSFC1(2)
                                                                                       <---------HSFC1(2)
                                                                                       <---------HSFB2a(1)
                              <-----------GT1                                          --------->HSFB2a(1)
       ------>MYB83        ----------->GT1               <---------KAN1               <---------ARR14(2)
       ------>MYB46(1)   <---------ANAC58            <---------ANAC58                 --------->ARR14(2)
     --------->AtMYB61   <---------ANAC46            <---------ANAC58                 <-----------ARR10
     <---------MYB59     <---------ANAC58    --------->ANAC58          <----------DOF2--------->SPL7(1)
     --------->MYB46(3) <---------TOE2(3)    <---------ALFIN1         <---------DOF5.7(1)     <-----
 ----------->HVH21      <---------TOE1(3)    --------->ANAC46     --------->ANAC46    ------->TEIL
 <---------ETT(1)      <---------DOF5.7(2)   --------->ANAC58     --------->ANAC58   <---------CCA1(2)
--------->DEAR3(2)   --------->DOF5.7(2)   ----------->RAV1(1)    --------->ANAC58 <---------ANAC55(2)
 
agacccgaccaaacaaaaaacatggttaacgtgtaacaacacagagccacacaagtgcgagtgtattccacgctctttccatcaacgcgtaccttcgtct  7445700
                                    <---------ICU4
                                    --------->YAB1
                                    <--------HAHB4
                                   <---------ATHB12                                     <----------DOF2
        <----------DOF2        ------------>CBF                                      ------>ZmHOX2a(2)
        <---------DAG2      <---------ANAC58                                       --------->ARR11(3)
     <-----------GT1        <---------ANAC58                     --------->KAN1    --------->GATA12
    <-----------GT1  <---------ANAC58          --------->RVE1(2)<-------TEIL --------->ATHB12
--------GT1          <---------ANAC58     <-----------GT1     *TSS       ------>ZmHOX2a(1)       <--
----DOF5.7(1)      <-----------GT1 <---------YAB5           ------->TEIL ===================HOX2a_HOX2a
 
taccattttaactttttttttttttcttgtttcttacaatcattttcacaaatctcttcgatgaagcttcattctcctcttgatttgatctctttgaaaa  7445800
                                       <---------YAB1
                                     --------->YAB5
                                     --------->YAB1
                                    ----------->GT1
                                    <---------YAB1
                                  <---------ICU4
                                  --------->YAB1
                                  --------->YAB5
                                 <---------YAB1
                               --------->YAB1
                               <---------ICU4
                               --------->YAB5
                              --------->ICU4                            ----------->GT1
                              <---------ATHB12                      -------->P
                        --------->ANAC58                        --------->RVE1(2)
         <---------MYB52(2) --------->WOX13(1)             ---------->DOF2
    <---------KAN1      --------->ANAC58                 --------->ARR11(3)
   --------->RVE1(2)    <<<<<<<<<<WRKY18          <---------LBD16<---------KAN1               <-----
--------ID1        <---------ZAT6--------->ICU4   --------->TOE1(2) ------->TEIL     <---------AHL12(2)
 
acgacgaatcaaacaaaccctagagtcaagtcaatcatgatgataaatacaaacctggaagataaagaatcaaccttgtgaaaaaaaaaaaaaacttttg  7445900
                                                                        --------->ANAC58
                                                                        --------->ANAC46
                                                                        --------->ANAC58
                   --------->AtLEC2                                  <---------ARR11(2)          <--
              --------->ANAC58                                       --------->ARR14(2)          ---
              --------->ANAC46                                       --------->ARR11(2)        =====
              --------->ANAC58                                 --------->ARR14(2)              -----
            ---------->DOF2                         --------->REM1(1)<---------ARR14(2)    ---------
          --------->HSFB2a(2)            <---------HSFB2a(2)   <---------ARR14(2)          <--------
   <---------DOF5.7(1)                   --------->HSFB2a(2)   <---------ARR11(2)  ------>ZmHOX2a(1)
  <---------DOF5.7(1)                 ------>ZmHOX2a(1)        --------->ARR11(2)  ----------->HVH21
----YAB1  <---------HSFB2a(2)   --------->GATA12--------->At4g35610 --------->DOF5.7(2)<---------MYB59
 
attccctcttcttctaaaagccatgaaaccgattcaatctccttctggagtagcttcacctatgaagaaccgtttacgcaaacgtcctgacctaagctta  7446000
                                                                                              ------
                                                                                  --------->ANAC46<-
             --------->bZIP60(1)                                                 <---------LBD16----
             <---------TGA1a                                                    ===============HOX2a_HOX2a
             --------->TGA1a                                                    ==============HOX2a_HOX2a
             <---------O2                                                  <---------DOF5.7(1)------
             --------->O2   --------->SPL7(1)                             <------NtERF2      <------
             <---------bZIP60(1)                                        <---------ANAC46     <------
             --------->bZIP60(2)                                      --------->LBD16       --------
             --------->DEAR3(1)                                       <---------ATERF1(1)   --------
        --------->DEAR3(1)  ------->TEIL                              ------>NtERF2------>NtERF2----
     --------->ANAC46     <---------SPL7(1)                          <---------DEAR3(1) ------>ZmHOX2a(2)
   <---------ALFIN1      --------->DEAR3(1)              <---------DOF5.7(1)    ------>ZmHOX2a(1) <-
-------ALFIN1<---------bZIP60(2)                        ------>ZmHOX2a(1)------>NtERF2 <------ZmHOX2a(2)
------>ZAT6  <---------DEAR3(1)              <---------ALFIN1    --------->At4g35610  <---------GATA12
=======================MYC_MYB            <---------ALFIN1       <---------At4g35610  <---------ARR11(3)
--->P<---------ALFIN1   --------------->AtSPL8   ------>ZmHOX2a(1)  <---------LBD16--------->LBD16--
>At4g35610 ------>NtERF2--------------->AtSPL3 <---------DOF5.7(1) <---------ATERF1(1)--------->GATA12
-At4g35610----------->HVH21<---------ALFIN1 <---------ZAT2  --------->KAN1--------->ATERF1(1)-------
 
ccactcccacaccgcgacgtcgctctcgccgtacctctccctctcccacctccttcttcctcttcatccgctccggcgtcttcctccgcgatctcaacca  7446100
                                                                                                 ===
                                                                                                 ===
                                                                                                 ---
                                                                                                 ---
                                                                                                 <--
                                                                                                 ---
                                                                                                 ===
                                                                                                 <--
                                                                                                 <--
                                                                                                 ---
                                                                                                 <--
                                                                                                 ---
       --------->At4g35610                                                                       ---
       ------>NtERF2                                                                             ---
      --------->RAP2.3(2)                                                                     ------
      --------->DEAR3(1)                                                                     <------
      --------->RAP2.6(2)                                 --------->LBD16                    <------
      --------->RRTF1(3)                                --------->ATERF1(1)                 <-------
     --------->RAP2.3(1)                                <------NtERF2                       <-------
    ------>NtERF2                                       <---------LBD16                     --------
    <---------ATERF1(1)                                ------>NtERF2                        --------
    --------->LBD16                                    <---------ATERF1(1)                  <-------
   --------->ANAC46                                   --------->ARR11(2)                    --------
   --------->DEAR3(1)                                 <---------ARR11(2)                    <-------
  <---------LBD16                                     <---------ARR14(2)                    --------
--->AtMYB61                                <---------ARR11(2)                               --------
----------ARR10                            --------->GLK1(2)   <---------ARR14(2)           ========
-->MYB83                --------->ZAT2     <---------GATA12<------NtERF2                    --------
->GAMYB<---------At4g35610                 --------->ARR11(2)  <---------ARR11(2)           ========
---MYB55(2)             <---------ZAT2------->TEIL--------->At4g35610                       ========
---MYB52(2)             --------->STY1(2)  <---------ARR14(2)  --------->MYB52(1)           --------
->ANAC58          --------->RVE1(2)   <-----------------AGL1   --------->ARR11(2)           --------
->ANAC58          --------->ARR11(2)<---------ZAT14   --------->ARR14(2)                  ------>NtERF2
-->MYB46(1)       <---------ARR11(2)--------->ZAT14  --------->ATERF1(1) ---------->DOF2 --------->DEAR3(1)
--------ARR11(3)  <---------ARR14(2)--------->ZAT18--------->ALFIN1      ===========================
------->ARR11(3) --------->KAN1    <---------KAN1 <---------At4g35610    ===========================
-->MYB46(3)---------->DOF2   <<<<<<<ZML2   --------->ARR14(2) <------ZmHOX2a(1)     <---------ALFIN1
 
acatctccgccgctaaaagcttatccgagctagaacgagtgaaccgaatcggaagcggagccggaggaacggtttacaaagtaatccacactccgacgtc  7446200
                                                      --------->ARR14(2)
                                                      <---------ARR14(2)
  ------>ZmHOX2a(1)                                   <---------ARR11(2)
  <----------DOF2                                     --------->AGP1
 <---------DOF5.7(1)                                  <---------ARR11(3)
=============bZIP_DOF                                 <---------AGP1
==============================bZIP_DOF                <---------RVE1(2)
------>O2                                             --------->RVE1(2)
------>ANAC58                                         --------->ARR11(2)
-------ANAC55(2)                                      --------->GATA12
------>ANAC58                                         --------->ARR11(3)
=======================bZIP_DOF                       <---------GATA12
-------O2                                            <---------CCA1(2)
-------TGA1a                                        ----------->ARR10
------>bZIP60(1)                                 <-----------HVH21
-------bZIP60(1)                                --------->ANAC58
------>bZIP60(2)                                <---------bZIP60(1)
------>ANAC55(2)                                --------->bZIP60(1)
------>TGA1a                                    --------->ANAC58
--->TGA2(2)                                     --------->bZIP60(2)
-----TGA1                                       <---------O2
-----HVH21                                      <---------TGA2(1)
--O2                                            --------->O2
--bZIP60(1)                              <---------ANAC58
->O2                                 --------->ARR11(3)
->bZIP60(1)                          <---------ARR11(3)                   ------>ZmHOX2a(2)
--TGA2(1)                 <---------ARR11(2)    --------->TGA1a         <---------ARR14(2)
->TGA1a                   --------->ARR11(2)    --------->TGA2(1)       --------->GATA12
--TGA1a                --------->ANAC46  <---------ANAC46               --------->ARR14(2)
->TGA2(1)              --------->ANAC55(2)      <---------TGA1a         --------->ARR11(3)
->bZIP60(2)            <---------ANAC55(2)<-----------HVH21             <---------ARR11(3)
=============bZIP_DOF <---------LBD16<---------ARR11(2)                 --------->ARR14(3)
->ANAC58             --------->MYB52(1)  <---------ANAC58               <---------ARR14(3)
==============================bZIP_DOF <---------At5g28300              <---------GATA12
=======================bZIP_DOF      --------->ARR14(2) ------>ZmHOX2a(2)<------ZmHOX2a(2)
->ANAC46           <----------DOF2   <---------ARR14(2)<------ZmHOX2a(2)--------->AGP1   <---------YAB5
->ANAC58    ---------->DOF2         <---------KAN1--------->TGA2(2)<------ZmHOX2a(2)    <---------RVE1(2)
==bZIP_DOF  ==============================================bZIP_DOF<---------GATA12 --------->ALFIN1
=======bZIP_DOF    =======================================bZIP_DOF--------->GATA12 <---------ZAT6
 
acgtcctttcgctctcaaagtgatttacggaaaccacgaagataccgtgagacgtcagatctgtagagagatcgagatcttaagaagtgttgatcatcca  7446300
<- Previous    Next ->

AGI:  At3g21215.1   
Description:  RNA-binding protein, putative. similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G42240.3); similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G42240.2); similar to nucleic acid binding [Arabidopsis thaliana] (TAIR:AT2G42240.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO23190.1); contains InterPro domain RNA recognition motif, RNP-1; (InterPro:IPR000504); contains InterPro domain Nucleotide-binding, alpha-beta plait; (InterPro:IPR012677)
Range:  from: 7441841    to: 7445309    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At3g21220.1   
Description:  ATMKK5 (MITOGEN-ACTIVATED PROTEIN KINASE KINASE 5); kinase. Identical to Mitogen-activated protein kinase kinase 5 (MKK5) [Arabidopsis Thaliana] (GB:Q8RXG3;GB:O80398;GB:Q96517); similar to ATMKK4 (MITOGEN-ACTIVATED PROTEIN KINASE KINASE 4), MAP kinase kinase/ kinase [Arabidopsis thaliana] (TAIR:AT1G51660.1); similar to double MYC-tagged mitogen activated protein kinase kinase 5 [synthetic construct] (GB:ABF55665.1); contains InterPro domain Serine/threonine protein kinase; (InterPro:IPR002290); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase-like (InterPro:IPR011009); contains Inte
Range:  from: 7445763    to: 7447357    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version