AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
     --------->At4g35610
     <---------At4g35610
     ----------->RAV1(2)
-------->P
-------KAN1
--->TEIL
------ARR11(2)
----->RVE1(2)
----->ARR11(2)
------GATA12
------ARR14(2)
----->GATA12                     <----------DOF2              --------->YAB1
--------ARR10                 --------->ANAC58                <-----------RAV1(2)
------ARR11(1)          --------->At4g35610                 --------->GLK1(2)
----->ARR14(2)        --------->MYB46(3)               ---------->DOF2
----->GLK1(2)       --------->MYB52(1)            --------->DAG2                              <-----
-----ARR14(1)  <----------ID1 --------->ANAC58   ---------->DOF2 <------ZmHOX2a(1)   <---------RVE1(2)
 
atctacccatctgaagatgagacaaaccgctgcaagctttaagaagatgagggaaagtgaaagaatcaggagaaacacgagcgagttgcatattggaata  4058800
                                  <-----------GT1
                                 <---------KAN1                            ----------->GT1
                           <---------ANAC58                             <---------TOE2(1)
                       --------->KAN4(2)                                <---------TOE1(1)
                     <---------WOX13(1)                               <------ZmHOX2a(1)
                   --------->ATHB12   ----------->RAV1(2)     <---------KAN1
        --------->GLK1(2)  <---------ANAC58                   --------->AHL12(1)                <---
   --------->DOF5.7(1)<---------MYB46(3) --------->YAB5       --------->KAN1--------->At5g28300 <---
----KAN1--------->ARR11(3) <---------ANAC46<---------YAB1    <---------KAN4(2)>>>>>>>>>GT-1     <---
 
catgagaagagcatcttggaagtgattgttccttgaataacccctgattatagcattccaagggaatatttgaggacgaggtaaatcgtcgaacacttgg  4058900
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                             -------
                                                                                          <---------ANAC58
                                                                                          <---------ANAC58
                                                                                        --------->ALFIN1
                                                                                       ------->MYC2
                                                                                       <-------MYC2
                                                                                       ------->MYC3
                                                                                       --------->TOE2(2)
          <-----------HVH21                                                            <-------MYC3
         <---------bZIP60(1)                                             <---------------AGL15 <----
         --------->bZIP60(1)                                             ===========================
    --------->YAB1                         <------MYB83      <---------ZAT14           --------->TOE1(2)
   --------->DAG2             <---------ANAC58               --------->ZAT14        <---------DOF5.7(2)
  ---------->DOF2             <---------ANAC46     --------->ANAC58     --------->TOE2(3) <---------ANAC46
------ANAC58                  <---------ANAC58     --------->ANAC58     --------->TOE1(3)<-------TEIL
------ANAC58            --------->ARR11(3) <------MYB46(1) --------->ANAC46     --------->ANAC58
------ANAC46    ---------->DOF2        --------->ZAT2   --------->MYB46(3)      --------->ANAC58<---
 
cgtgcaaaagtaatgtcaccaaaggaagagctagcgtgaatgagcttggtgatcaagaaaccactgaactgcaaacctaaaacaagtaaacgtgcgtgga  4059000
     <---------ZAT2
     --------->At4g35610
     <---------At4g35610                                                      ----------->RAV1(1)
     ----------->RAV1(2)                                                    --------->At4g35610
     --------->ZAT2                                                         --------->ZAT18
   <-----------RAV1(2)                                                      <------NtERF2
<---------ANAC58                                                            <---------ZAT14
<---------ANAC58                                                  --------->LBD16
---->ARR14(2)                                                    --------------->AGL15
---->ARR11(2)                                                    --------->HSFB2a(2)
-----ARR14(2)                                                    <---------HSFB2a(2)
-----RVE1(2)                                                    ----------------->AGL2
-----ARR11(2)                            <---------ANAC46       <-----------------AGL1
---->GATA12      --------->ATHB12        ----------->GT1        ----------------->AGL3
---->ARR10  <---------DAG2  <---------YAB1           --------->YAB1      --------->At4g35610
-----GATA12 <----------DOF2--------->RVE1(2)       --------->GLK1(2)<---------GLK1(2)
==================================================================================MADS_MADS
------GLK1(1)   <---------YAB1     <---------------------WRI1   <-----------------AGL2    <---------AHL12(2)
 
tttgcttcagctgagctttatgagtggcactatcaataagcgaagcgtagaaagaatcagaatggattccagaattggctgcaccaaaaaaaaaaaaaac  4059100
                                                                                          <---------ETT(1)
                                                                                      <---------ANAC58
                                                                                      <---------ANAC58
                                                                                     --------->HSFB2a(1)
                                                                                     <---------HSFB2a(1)
                                                                                     --------->HSFC1(2)
                                              <---------ARR11(3)            --------->ANAC58      <-
                                              --------->ARR11(3)            --------->ANAC58    ----
                                 --------->ANAC55(2)              --------->DOF5.7(1)<---------HSFC1(2)
         <---------MYB46(3)      --------->ANAC58               ---------->DOF2    <---------ARR11(3)
     <---------AtMYB61           --------->ANAC46        <---------ZAT14--------->ANAC58  >>>>>>>>>>AtTINY2
   <----------DOF2               --------->ANAC58        --------->ZAT14--------->ANAC58  ----------
 
atttcactttggtggttttgggattgaattggacataagtaacaagagagttcttcttactgtagagcaaaggagaagcaagacaagatgcttccgacat  4059200
                                                                      ------------>CBF
                                                        --------->ZAT18                       <-----
  <-----------GT1                            --------->AHL20(2)      --------->RVE1(2)        <-----
 <---------YAB1     *TSS                     <---------AHL20(2) <-----------GT1               ------
--------YAB1      <---------YAB1        <--------HAHB4  <---------ZAT14              --------->ANAC55(2)
------->GT1    ------>ZmHOX2a(1)        <---------ICU4  --------->ZAT14              <---------ANAC55(2)
->HVH21       --------->TOE2(3)        <---------ATHB12 <---------ZAT18            <-----------GT1
 
ggttattactctgtcttccttactattagttttgttatctccatcattttaaatagtagcacactattcacatatcaatgtttgaattacatgttttctc  4059300
                                          <---------O2
                                          <---------ANAC58
                                          <---------bZIP60(2)
                                <---------AHL25(2)
                                --------->AHL25(2)
                                --------->AHL12(2)
                                <---------AHL12(3)
                                <---------AHL12(2)
                                --------->AHL12(3)
                               <---------AHL20(1)
                               --------->ARR11(3)
                               <---------AHL25(2)
                               --------->AHL25(2)
                               --------->AHL20(1)
                               <---------AHL25(3)
                               --------->AHL12(2)
                               <---------AHL12(1)
                               <---------ARR11(3)
                               --------->AHL12(1)
                        ----------->GT1   <---------ANAC46
           --------->AHL25(1) <---------AHL12(3)
           <---------AHL25(1) --------->AHL12(3)
           <---------AHL25(3) <---------AHL25(1)
           <---------AHL12(3) --------->AHL25(3)
           <---------AHL20(2) <---------AHL12(1)                                           <------NtERF2
          --------->AHL25(3)  --------->AHL25(1)                                 <---------DOF5.7(1)
          --------->AHL20(2)  --------->AHL12(1)                                <----------DOF2
          <---------AHL12(1)  <---------AHL20(2)                            --------->ANAC58
          --------->AHL12(1) --------->ICU4                                 --------->ANAC46
          <---------AHL20(2) --------->AHL25(3)                        ------>MYB83        ---------
  <---------YAB1      <---------ANAC58    <---------TGA1a              ------>MYB46(1)     <--------
 <XXXXXXXXXXXXXXXXXXXXMIR862-5P<---------AHL12(2)                     ----------->RAV1(1) <------NtERF2
<---------KAN1        <---------ANAC58    =================================================bZIP_DOF
----LBD16<---------WOX13(1)  --------->AHL12(2)--------->PCF2        --------->AtMYB61    <---------LBD16
----HSFB2a(2)     ---------->DOF2         <---------ANAC58------>ZmHOX2a(1) --------->ANAC58
--->HSFB2a(2)     ==================================bZIP_DOF        --------->MYB46(3)   <---------LBD16
 
ggaatatgtttgatttatttgaaaagcttgtaaatattttttgtgacttgggcccattctcctaattctctaccaacacaagccttttaaggcccgggga  4059400
                                                                       <---------TOE2(3)
                                                                       <---------YAB1
                                                                   --------->WOX13(2)
                                                                   <---------AHL12(2)
                                                                   <---------WOX13(2)
                                                                 --------->AHL20(1)
                                                                 --------->AHL12(1)
                                                                 <---------AHL20(1)
                                                                 --------->AHL25(1)
                                                                 --------->AHL20(2)         --------
                                                                 <---------AHL25(2)       <---------AHL20(3)
                                                                 --------->AHL25(3)       --------->AHL20(3)
                                                                 <---------AHL25(3)       --------->AHL12(3)
                                                                 <---------AHL12(1)       <---------AHL12(3)
                                                                 --------->AHL25(2)     <---------YAB1
                                                                 <---------AHL25(1)    <---------AHL20(1)
                                     --------->AHL12(2)          <---------AHL20(2)    <---------AHL20(3)
                                     <---------AHL12(2)          <---------AHL12(3)    --------->AHL20(1)
                                    -------->HAHB4               --------->AHL20(3)    --------->AHL25(2)
                                    <---------AHL25(3)           <---------AHL20(3)    <---------AHL20(2)
                                    <--------ATHB1              <---------AHL25(1)     --------->AHL20(3)
                                    --------->AHL12(1)          --------->AHL20(2)     <---------AHL25(1)
                                    <---------AHL12(1)          <---------AHL12(3)     <---------AHL25(2)
                                    --------->YAB5              --------->AHL12(3)     <---------AHL25(3)
                                    <---------ICU4              <---------AHL20(2)     --------->AHL25(3)
                      --------->ANAC58        ---------->ID1    --------->AHL25(1)    --------->YAB1
       <---------AHL25(2)           --------->YAB1              --------->AHL25(3)    --------->AHL20(2)
       <---------AHL12(3)          <---------ATHB51             --------->AHL12(1)   <---------YAB1
       --------->AHL25(1)          --------->ICU4               <---------AHL12(1)  <---------AHL20(3)
       --------->AHL12(2)          <---------YAB5              --------->AHL12(2)   --------->AHL25(2)
       <---------AHL20(2)         <---------AHL12(2)           <---------AHL12(2) <---------YAB1
    <---------RVE1(2) --------->ANAC58   <----------DOF2      <---------AHL12(2) <---------GLK1(2)
>LBD16--------->AHL12(1)          --------->AHL12(2)        --------->AHL20(2)  --------->YAB5     -
-LBD16<---------AHL12(1)         --------->YAB1  ------>ZmHOX2a(1)<---------AHL12(2)--------->AHL20(3)
 
gcgatttgatttttttttttagggcaaacaatgtattaataattctttagtcctattgaatgaaaaaataaattaagattgaaagattattatatttata  4059500
                                         <---------YAB5
                                       --------->YAB1
                                      --------->AHL12(1)
                                      <---------AHL12(1)
                                     --------->AHL20(3)
                                     <---------AHL20(3)
                                     --------->AHL25(2)                                 ------>MYB83
                                     <---------AHL25(2)                                 ------>MYB46(1)
                                    <---------AHL12(2)      --------->YAB1            <---------MYB59
                                    --------->AHL12(2)      --------->YAB5            <-------------
     --------->YAB1                 --------->YAB1 <------ZmHOX2a(1)                 ---------------
  --------->YAB1         <---------TOE2(3)--------->YAB1   <---------YAB5            <--------------
  <---------ICU4   <---------AHL20(1)--------->AHL12(2)   ------->TEIL               ---------------
  --------->YAB5   <---------ARR11(3)<---------AHL12(2) --------->YAB5       ------------>MYB.PH3(1)
->YAB1     ---------->DOF2 <------ZmHOX2a(1)     <---------TOE2(3)     ----------->GT1--------------
-------->YAB1   ----------->GT1----------->GT1   <---------TOE1(3)  ------------>MYB.PH3(2)        -
 
actaataataacaaataagcagtatatttaggattagaaaaataatcatattaaggaaatgaatcataagaagtttgttaaaacagttaccaaataagaa  4059600
                   <---------YAB5
    --------->AHL20(2)
    <---------AHL20(2)
    <---------AHL12(1)
    --------->AHL12(1) --------->ARR11(3)
    --------->AHL25(1) --------->RVE1(2)
  <---------WOX13(2)--------->YAB1
  --------->WOX13(2)<---------ICU4
--AGL15          --------->YAB1                       --------->AHL20(2)             ------>ZmHOX2a(1)
-->AGL1          <---------ICU4     <---------KAN1 --------->TOE2(3)                --------->TOE2(3)
---AGL3      <-------TEIL          --------->RVE1(2)<----------DOF2            ------>ZmHOX2a(1)
-->AG--------->WOX13(1)<---------ARR14(2)      --------->KAN1                 <---------MYB59
->AGL15<---------YAB5 <---------CCA1(2)    <-----------GT1               <----------DOF2          --
----------->CBF --------->ICU4     --------->GLK1(2)------>ZmHOX2a(1) <---------TOE1(3)          ---
 
aacacaattaatcaggctcataatcatatctcggtgagaatctatataacttatcctttaattcttagggtttaagcttttcctaatcctaaatgacatt  4059700
<- Previous    Next ->

AGI:  At3g12770.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT3G23330.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO24211.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 4056837    to: 4059221    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version