AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                   <---------ARR11(3)
         <-------TEIL    --------->KAN1            --------->ARR11(3)
         <---------ZAT18<---------AHL12(1)         --------->ARR14(2)            --------->LBD16
  --------->ANAC46      <---------AHL25(3)         --------->RVE1(2)            --------->ANAC46
-------->ARR14(2)      <---------AHL25(1)          <---------ARR14(2)        --------->ARR14(2)  ---
---------ARR14(2)      --------->AHL20(2)         <---------KAN1    --------->RVE1(2)           <---
---------ARR11(2)      --------->AHL25(1)   --------->ARR11(2)      --------->GATA12            ----
-------->ARR11(2)      --------->AHL12(3)   <---------ARR11(2)      <---------GATA12      --------->KAN4(2)
-------->RVE1(2)       --------->AHL25(3)   --------->ARR14(2)      --------->ARR14(2)   --------->MYB46(3)
----->ANAC55(2)   ------>MYB46(1)           --------->RVE1(2)       <---------ARR14(2)   <---------KAN4(1)
------ANAC55(2)   ------>MYB83              <---------ARR14(2)     <---------CCA1(2)     --------->HSFB2a(1)
----KAN1 --------->ZAT18<---------AHL25(1) <---------CCA1(2)       ------>MYB83<---------LBD16<-----
---ARR11(2)<----------DOF2<---------GATA12 --------->GLK1(1)       ------>MYB46(1)       <---------KAN1
 
catatccacaagtgcattacctacaaataaatccgattcaaaacccatatccaatatctgttcataaaccaaatctcccatctccgcatcgaacaatccc  863000
                                                               ----------->GT1
                                                           <---------ARR11(2)
                                                          <---------KAN1
                                                         --------->HSFB2a(1)
                                                         --------->HSFC1(2)
                                                         <---------HSFB2a(1)
                                                         <---------HSFC1(2)
                                                      --------->LBD16
                                                     --------->ANAC46
                                                    <---------HSFB2a(2)
                                                    <---------LBD16
                                                 --------->GLK1(1)
                                 <---------LBD16 <---------GLK1(1)
                                 <-----------RAV1(2)--------->HSFB2a(2)                      <------
                             --------->ICU4     --------->ARR14(2)                           -------
                       <-------MYC3             --------->ARR11(2)                      <---------KAN1
       --------->YAB1  ------->MYC3 <------ZmHOX2a(1)--------->LBD16                    --------->MYB46(3)
    <----------DOF2    <---------------AtSPL8   --------->GATA12--------->LBD16         <---------MYB52(2)
------>ANAC46         <---------ANAC46          <---------GLK1(2) ---------->DOF2  --------->LBD16
------LBD16        <---------ARR11(2)      --------->TOE2(3)   --------->LBD16     --------->ANAC46
----->LBD16        --------->ARR11(2)      --------->TOE2(2)   --------->ANAC46  <-----------RAV1(2)
----LBD16    ------->GAMYB ------->TEIL    --------->TOE1(2)  <---------LBD16  <----------DOF2   ---
 
gcgcaggctttgataaccgaaggaaacgtgtacttatcaggagaaaccttggattcccggagtttcccgtaaaactcgagggcttcagggaacaaaccat  863100
                 <---------WOX13(1)
               --------->ATHB12                                                           ----------
               --------->YAB5                                                           --------->ANAC58
              <---------YAB1                                                            --------->ANAC46
            --------->YAB1                                                              --------->ANAC58
     --------->DAG2                                                                  <-------TEIL
     --------->DOF5.7(1)  --------->LBD16                                         <------NtERF2
    ---------->DOF2      <---------HSFB2a(2)   <------NtERF2                    <---------ANAC58
    --------->DOF5.7(1)  --------->HSFB2a(2)  --------->LBD16                   <---------ANAC46
---------AGL15<---------YAB5                  <------NtERF2                     <---------ANAC58
-->YAB5     <---------At4g35610   <---------YAB5   --------->KAN1           --------->DOF5.7(1)
------>TOE2(3)--------->ICU4 ----------->GT1<---------LBD16                --------->DOF5.7(1)     <
 
tcttagaaaaagctctgatgattgaattccagaggtaaacatttttggccggagaaactcgtcggaaaacagagagggaagaggcgggttcacgaaagtg  863200
                                                                                                ----
                                                                     <---------ARR14(2)        -----
                                                                <---------ANAC46               -----
                                      <-----------HVH21         <---------ANAC58       <---------TOE1(3)
                 --------->MYB52(1)<---------At4g35610          ----------->GT1        <---------TOE2(3)
  <---------ANAC58  --------->LBD16--------->At4g35610          <---------ANAC58   <---------WOX13(2)
  <---------ANAC58<---------LBD16  <---------ZAT2      <------ZmHOX2a(2)       <---------At4g35610<-
>DOF2        --------->At4g35610   --------->ZAT2     <---------ARR11(3)      ------->TEIL   <------
---------ZAT14   -------->P      <------NtERF2        --------->ARR11(3)   --------->ANAC46  -------
 
agagtacttgtcgataagcttaccggagaagaagtcggagctgtcaagaccaagagagatcacaagggcgtgaattcgacgaagctcattgaggttagat  863300
                                                                                                   <
                                                                                                  --
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
                                                                                                  <-
                                                                                                  --
                                                                                                  --
     --------->DOF5.7(1)                                                                          --
   ---------->DOF2               --------->ANAC58                                                 --
----->YAB5                       --------->ANAC58                           <------------CBF      <-
------>HVH21                --------->bZIP60(1)                            --------->ATHB12       --
------>TGA1                 <---------bZIP60(1)                           <---------YAB5          <-
---------ID1          --------->DOF5.7(1)                        <-----------GT1                  <-
---At4g35610          --------->DAG2             >>>>>>>>>>>>>>>>>LFY<---------DOF5.7(1)         <--
-->At4g35610        ---------->DOF2--------->ZAT14        *TSS  <-----------GT1                  ---
 
gacgacgaaagagctctagagatgaaaggtgatgacactctagtctgcatttcgccattgtagagttttacctcttcttcattgttttagtttccatcga  863400
  <---------AHL25(3)
  -------->HAHB4
  <---------AHL20(2)
  <---------ICU4
  <---------AHL12(1)
  --------->AHL12(1)
 <---------YAB1
 <---------ATHB51
 <---------YAB5
 --------->ICU4
--------->AHL12(2)
--------->WOX13(2)
<---------AHL12(2)
<---------WOX13(2)
---------AHL25(3)
------->AHL12(1)
--------AHL20(2)
--------AHL25(3)
------->AHL25(3)
--------AHL12(3)
------->AHL20(1)
------->AHL20(2)                             --------->LBD16                               ---------
------->AHL20(3)                        <-----------GT1                               --------->ANAC58
------->AHL25(1)                      ---------->TaMYB80                              --------->ANAC58
--------AHL25(2)                      <---------KAN4(2)                     --------->ANAC58   -----
------->AHL25(2)                   --------->LBD16                          --------->ANAC46------->GAMYB
--------AHL25(1)                 <---------LBD16                            --------->ANAC58--------
--------AHL12(1)         --------->AHL12(1)  ----------->GT1               --------->LBD16 ---------
-------KAN1              <---------AHL12(1)<---------LBD16           <----------DOF2  --------->AtLEC2
------>AHL25(3)          --------->KAN1<---------KAN1             <-----------GT1     --------->ANAC46
 
attaattattcaaaacagaacaaaacaaatattcaaaccggaataacccggtttaaaccgagaaacttatttcttttccacgaaaaaacatgcaacgacg  863500
              <----------DOF2
        ------->GAMYB
        <---------ETT(1)
        ----------->HVH21
        --------->At1g77200
        --------->DREB2C(2)                                                         --------->ARR14(2)
        --------->ANAC46                                                            <---------ARR14(2)
        --------->DEAR3(1)                                                          --------->ARR11(2)
        --------->RAP2.6(2)                                                         <---------ARR11(2)
        --------->RAP2.3(3)                                                      <---------ANAC58
       --------->DEAR3(2)                                                     --------->ARR14(2)
       --------->RAP2.3(1)           --------->GATA12                         --------->GATA12
      <---------At4g35610            <---------ARR11(3)                       <---------ARR11(2)
      <---------ATERF1(1)            --------->ARR14(2)                      <---------At4g35610
      --------->At4g35610            <---------ARR14(2)                      --------->At4g35610
---------->DOF2                      <---------RVE1(2)                       --------->KAN1
>DEAR3(1)  <---------ALFIN1          --------->ARR11(3)           <---------YAB1 <---------ANAC58
---->YAB5<---------RAP2.6(3)         <---------GATA12         <---------RVE1(2) <-------TEIL
->YAB5--------->ZAT2   <---------RVE1(2)               <----------DOF2     <-----------RAV1(2)    <-
>MYB46(3)------>NtERF2 --------->GATA12------>ZmHOX2a(2)  <---------At4g35610<---------ZAT2      ---
 
attcaaagcagccgacacttttgttagacctggttatgtcgatcttgcaacgcttgagctttgctgattttcatagagccagatgcgtttcttcagaatg  863600
                                                                                       <---------ANAC55(2)
                                                                                    <---------YAB5
                                                                                  --------->YAB1
                                                                                 <-------TEIL
                                                                              <--------ATHB1
                                                                              --------->ATHB12
                                                   --------->AtLEC2           --------->YAB5
                                            --------->YAB5                   --------->ICU4
                                      --------->YAB5                         <---------YAB5
                         --------->MYB46(3)<---------YAB1                    <---------YAB1
               --------->AtLEC2       --------->YAB1                         <---------ATHB12
--------ARR14(2) --------->YAB1      <------ZmHOX2a(2)   <---------KAN1    --------->YAB1
------>KAN1 <---------ATHB12        <---------RVE1(2)    --------->KAN1 ----------->RAV1(1)   ------
 
gtattcggcttcgaaatcatgcataacaacaactccatggatcatcacgattccatacaaatattcgaaaaacagcaacaatgattcatcatgtaagttg  863700
                                                                              <---------MYB52(1)
                                                                            --------->HSFB2a(2)
                                                                            <---------HSFB2a(2)
                                                                           <---------LBD16
       ----------->HVH21                     <---------RVE1(2)           --------->ARR14(2)
     <---------O2                         <---------WOX13(1)             <---------ARR14(2)
     --------->O2                    <---------LBD16                     --------->ARR11(2)
    =====================================HOX2a_HOX2a                     <---------ARR11(2)
    ------>ZmHOX2a(1)             <------ZmHOX2a(2)                     <---------GLK1(1)
 <------ZmHOX2a(2)               <---------ARR11(3)                    ----------->ARR10
<---------GATA12                 <---------GATA12                    <---------ANAC58
<---------ARR11(2)               --------->GATA12                    <---------ANAC58
--------->GATA12                 --------->ARR11(3)                  <---------ANAC46
<---------ARR14(2)               --------->ARR14(3)             <---------ANAC58    ----------->GT1
--------->ARR14(2)              --------->GLK1(1)               <---------ANAC58<---------MYB46(3)
--------->ARR11(2)              <---------GLK1(1)            <---------MYB52(1)<--------P
<---------RVE1(2)   <-----------GT1 <---------LBD16        <---------MYB46(3)--------->LBD16
--->KAN1         <---------MYB46(3)------>ZmHOX2a(2)      <---------YAB5--------->GLK1(1)      <----
 
ttcgatcctcgtgacaatagttgttacacattaagagatctcgggattgatatggctacgagtcgttgtttggcgagttccggtagatggtttcttctgt  863800
                    <----------DOF2
                   <---------DOF5.7(1)
           <---------GATA12
           --------->GATA12                     <---------HSFC1(2)
           <---------GLK1(2)                    <---------HSFB2a(1)
           --------->ARR11(3)                   --------->HSFC1(2)
           <---------RVE1(2)                  <---------ARR14(2)            <---------GLK1(1)
           <---------ARR11(3)                 <---------GLK1(2)             --------->GLK1(1)
         ----------->ARR10--------->GATA12    --------->ARR14(2)           <---------GATA12 --------
       --------->TOE2(3)  ------->TEIL        <---------ARR11(2)  --------->WOX13(1)       <--------
 --------->AtMYB61 <---------DAG2            <------ZmHOX2a(1)  <---------YAB5          --------->ICU4
-----MYB52(1)   <-----------GT1 --------->ZAT14 --------->HSFB2a(1) <---------ATHB12  ------->TEIL -
 
tagaccataacctagattttcaccttttgaatctgtttactagagagaggattcttccgactcttgaatcaatcgatggatttccgatggacttatgaga  863900
<- Previous    Next ->

AGI:  At3g03580.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT4G18750.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO17828.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN83351.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 860519    to: 863359    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version