AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                              <-------TEIL
                                                           <------MYB83
                                                           <------MYB46(1)
                                                   --------->WOX13(2)                           ----
                                                <---------------AGL15                           ----
                                               --------->TOE2(3)                                <---
                                       ---------->DOF2    <---------------AtSPL8                ----
                                     --------->WOX13(2)   --------->MYB46(2)<---------KAN1      ----
                                     <---------WOX13(2)   --------->MYB59 ----------->GT1      <----
                                  ==============================MADS_MADS<------ZmHOX2a(1)     -----
                          ----------->GT1      --------->TOE1(3)       <---------TOE1(3)       -----
                <---------ANAC46  --------------->AGL15   --------->MYB111(1)           --------->At4g35610
                ----------->GT1  --------->TOE2(3) <---------WOX13(2)  <---------TOE2(3)<---------At4g35610
-ATHB12         <---------MYB46(3)<---------------AGL15  <--------P--------->YAB1--------->ATHB12
 
tgacataaaaacaccagggtcgtttaaactagtaaaacttaataaaggaaccttaatagagtaggtacaatgttaaggagtaaatgagtgaagctcaaga  19669300
                                                                     --------->ATHB51
                                                                     <---------ICU4
                                                                    <---------YAB5
                                                                    <---------YAB1
                                                                   <---------AHL25(2)
                                                                   --------->AHL20(3)
                                                                   --------->AHL12(3)
                                                                   --------->AHL12(2)
                                                                   <---------AHL20(3)
                                                                  --------->YAB1
                                                                  <---------ICU4
                                                                <---------AHL25(2)
                                                                --------->AHL20(3)
                                                                --------->AHL25(2)
                                                                --------->AHL12(3)
                                                                --------->AHL12(2)
                                                                <---------AHL20(3)
                                                               <---------ICU4
                                                               --------->YAB1
                                                              <---------YAB1
                                                        <---------AHL12(3)
                                                        <---------AHL20(3)
                                                        --------->AHL25(1)
                                                        --------->AHL20(3)
                                                        <---------AHL20(2)
                                                       --------->AHL12(1)
                                                     --------->ARR11(3)
         ---------->DOF2     <---------WOX13(1)      <---------ARR11(3)     --------->ANAC58
----->CCA1(2)               <---------WOX13(2)      <------ZmHOX2a(1)--------->ATHB12
----->GLK1(1)              --------->ATHB12        --------->ICU4--------->ICU4
------GLK1(1)             <---------YAB1          <---------TOE2(3)--------->AHL25(2)
----->KAN1 --------->DOF5.7(1)           --------->ANAC58    --------->AHL12(2)                    -
----->RVE1(1)            <---------MYB52(1) ---------->DOF2<---------AHL20(2)              ---------
-----ARR11(3)           <-------GAMYB    --------->ANAC58  <---------YAB1   --------->ANAC46      --
---->ARR14(2)     <------ZmHOX2a(1)  <------ZmHOX2a(1)<---------RVE1(1)     --------->ANAC58      <-
---->ARR11(3)  <------ZmHOX2a(1)    --------->ZAT18<---------YAB5<---------YAB1       --------->CCA1(2)
 
tatcccatgagacaaagaggaggactctgttgattgaagaggactagcaaagtaaggatttttttattattattattgcaagcaagaagatagagaaaga  19669400
       --------->HSFB2a(2)
     ------>MYB83
     ------>MYB46(1)                                                            --------->RVE1(2)
  --------->ZAT2                                                                <---------ARR14(2)
  ----------->RAV1(2)                          >>>>>>>>>>>>>>>>>LFY             --------->ARR14(2)
 ------>MYB83                      ----------->RAV1(1)                          <---------ARR11(2)
 -------->P                      --------->ZAT18                                --------->ARR11(2)
 ------>MYB46(1)       ----------->RAV1(1)     <<<<<<<<<<<<<<<<<LFY            <---------CCA1(2)
-------->AtMYB61      <----------ID1          --------->ANAC58           <------ZmHOX2a(2)
->DOF2 <---------HSFB2a(2)  ---------->DOF2   --------->ANAC46         --------->YAB5
------->MYB46(3)    --------->ANAC58          --------->ANAC58         ------->GAMYB      <---------YAB1
--------MYB52(2)    --------->ANAC58 --------->AtMYB61          ---------->ID1 --------->KAN1
 
aaccaacctgccagaagaagcgaaggcaacaagaagcccaccaaaaaactcgccattggaaacttttgtcttaacgatcaccatatcccaattctcatcg  19669500
                       ------>NtERF2
                      <---------ETT(1)                                                 <---------AHL12(2)
                  <---------ZAT2                                                      --------->AHL12(3)
                  --------->ZAT2                                                      <---------AHL12(1)
           <---------ALFIN1                      --------->ANAC58                     --------->AHL12(1)
         XXXXXXXXXXXXXXXXXXXXX>MIR853            --------->ANAC58                     <---------ICU4
        ------>ZmHOX2a(2)                      --------->MYB52(1)                    --------->AHL25(3)
       <------ZmHOX2a(2)                  --------->DAG2         <------NtERF2      <---------AHL12(3)
      --------->GATA12----------->HVH21   --------->DOF5.7(1)   --------->LBD16     --------->AHL25(1)
      <---------GATA12--------->DEAR3(1) --------->DOF5.7(1)  <------NtERF2         --------->AHL20(3)
      <---------ARR11(2)                 ---------->DOF2     <------NtERF2          --------->AHL12(3)
      --------->ARR11(2)                ---------->DOF2      ------>NtERF2          --------->AHL12(2)
      --------->ARR11(3)              --------->HSFB2a(2)    <---------ATERF1(1)----------->GT1
      <---------ARR14(2)              <---------HSFB2a(2)   --------->ANAC46    <------ZmHOX2a(1)
      <---------ARR11(3)        <---------ARR11(3)------->GAMYB--------->DEAR3(1)   <---------AHL20(3)
      --------->ARR14(2)  --------->TOE2(3)   <---------WRKY12<---------LBD16  ----------->GT1
 
aattcaatagatcccctctctagctccgacctcaatttcttccaaaaggccaacgaaatcagcccgccggagactaaaacggaggataaaaatttccaat  19669600
                               <---------MYB46(3)
                             <---------At4g35610
                             <---------ZAT2
                        --------->DOF5.7(1)
                        --------->DAG2
                       --------->DOF5.7(1)
                       --------->DAG2
                      ---------->DOF2
                    --------->LBD16                                                               --
                   --------->LBD16                                                                <-
                   --------->ANAC46                                                               <-
                  --------------->AGL15                                                           <-
                  <---------------AGL15                                                           --
                  --------->HSFB2a(2)                                                             --
                  <---------HSFB2a(2)                                                             --
                 <-----------------AGL1   <---------ANAC58                                  <-------
          <---------STY1(2)  --------->At4g35610                    <---------ARR14(2)      --------
          --------->STY1(2)<--------P     <---------ANAC46          <---------GATA12        --------
 --------->ANAC58<-----------------AG     --------->ALFIN1   <---------ANAC58              ---------
 --------->ANAC58----------------->AGL1   <---------ANAC58   <---------ANAC58         *TSS <--------
 
tctcacgaattctagcaagttcccgaaaaggtagctgttgaagatgtgtgtgaatttgaaggtggattgcaaatttgagagaattggaaactggaaatcc  19669700
                                                              <---------YAB1
                                                             <---------AHL20(1)
                                                             <---------AHL20(2)
                                                             --------->AHL20(3)
                                                             <---------AHL25(1)
                                                             <---------AHL20(3)
                                                             <---------AHL25(3)
                                                             --------->AHL25(3)
                                                             <---------AHL25(2)
                                                             --------->AHL25(1)
                                                             --------->AHL25(2)
                                                            --------->AHL12(3)
                                                            <---------AHL20(2)
                                                            --------->AHL20(2)
                                                            <---------AHL12(1)
                                                            --------->YAB1
                                                            --------->AHL12(1)
                                                            --------->AHL25(3)
                                                            <---------AHL12(3)
                                                        <---------AHL20(1)
                                                        --------->AHL20(1)
                                                        --------->AHL12(1)
                                                        <---------AHL12(1)
                                                        --------->AHL20(2)
                                                        <---------AHL25(1)
                                                        --------->AHL25(2)
                                                        <---------AHL20(2)
                                                        --------->AHL25(3)
                                                        <---------AHL25(3)
                                                        <---------AHL25(2)
                                    ------------>CBF    <---------AHL20(3)
                                   --------->ANAC58 <---------YAB1
                                   --------->ANAC46--------->AHL25(3)
                          <----------DOF2          --------->AHL20(2)
                         ------>ZmHOX2a(2)         <---------AHL20(2)
                         <---------DOF5.7(1)       <---------AHL20(3)
     --------->ANAC46   <------ZmHOX2a(2)          --------->AHL20(3)
     --------->ANAC58   <---------RVE1(1)      <---------ICU4--------->AHL20(1)
     --------->ANAC58  <-----------ARR10      <---------YAB5<---------AHL25(3)
------->GATA12         <---------ARR14(2)     <---------YAB1<---------AHL25(1)
--------ARR14(2)       <---------ARR11(3)   --------->YAB1  --------->AHL25(1)                    <-
--------ARR11(2)       --------->ARR14(2)   <---------ICU4<---------AHL12(2)                    ----
--------GATA12         <---------ARR14(3)  <---------YAB5--------->AHL12(2)                     ----
------->RVE1(2)        --------->ARR14(3)  --------->ICU4<---------AHL12(2)                     ====
------->ARR14(2)       <---------GATA12  --------->YAB1 --------->AHL25(1)                  --------
------->ARR11(2)       --------->ARR11(3)<---------ICU4--------->AHL25(3)                  <--------
--GATA12               --------->GATA12 --------->ICU4<---------WOX13(2) --------->LBD16  --------->RVE1(2)
->RVE1(2)            --------->DOF5.7(1)<---------ATHB12--------->AHL20(3)      ----------->GT1 <---
->GATA12           ---------->DOF2 --------->ANAC58--------->AHL25(1)    ------>NtERF2    ------>MYB46(1)
>GLK1(1)       ---------->DOF2    <---------HSFB2a(2) --------->WOX13(2)--------->DEAR3(1)------>MYB83
-GLK1(1)    --------->RVE1(2)     --------->HSFB2a(2)--------->YAB1    <------NtERF2     --------->WOX13(1)
 
aaatccacaagcaaaaatcaaagaaagatcttttcttctcgcaataatcatcattttaataaattatatttagcgccgagaaatggctaaaccaatcaaa  19669800
                         <---------WOX13(1)
                        <---------ANAC58
                        <---------ANAC58
                        <------------CBF
                    <------------CBF
                   <---------ICU4
                   --------->ATHB51
                   <--------ATHB1
     <---------PCF2-------->ATHB1
    <---------DEAR3(2) --------->ATHB12
   <---------DEAR3(1) <---------YAB5
   <---------ZAT18 --------->ATHB12
============================================bZIP_DOF
<---------ANAC46  <---------YAB1      --------->WOX13(2)
<---------TGA1a   <---------ATHB51    <---------WOX13(2)
--------->TGA1a   --------->ICU4<---------ANAC58          <-------GAMYB
<---------O2      <---------ATHB12  --------->AHL20(2)   <------MYB46(1)
--------->O2 --------->GLK1(2)  <---------ANAC46     --------->GLK1(1)
----------HVH21------------>ATHB5<----------DOF2     <---------GLK1(1)
----->DEAR3(2)------------>CBF  <---------ANAC58  --------->LBD16               <---------ATHB12
----->MYB46(3)<-------TEIL    ------>NtERF2     <---------LBD16                <---------WOX13(2)
==========MYC_MYB<---------WOX13(2) <---------AHL20(2)   <------MYB83          --------->WOX13(2)
->YAB1      --------->GATA12<---------ANAC58   --------->MYB52(1)           ------------>CBF
-ATHB12     <---------GATA12<---------ANAC58  <---------KAN1     <------------CBF---------->DOF2
---------AtMYB77 --------->WOX13(2) --------->AHL25(3)  --------->MYB59  ----------->GT1          <<
 
ccgtcgtgggctcgagattcaattattgattgctggcttttaatttggaataccggagttcggttgagaattggaccggttcaataaagccaacaagttt  19669900
                                                  --------->ANAC58
              --------->ATHB12                  <---------ALFIN1
              <---------KAN1                   --------->At4g35610
             <---------ATHB51                  --------->ZAT2
             <---------YAB1                 <---------ZAT14--------->ATERF1(1)
             --------->ICU4                 <---------At4g35610
    ------>ZmHOX2a(1)              <------MYB46(1)--------->ANAC58
   --------->TOE2(3)               <------MYB83<---------At4g35610                      <----------DOF2
   <---------ANAC58               <---------AtMYB61        <---------GLK1(1)           <---------ANAC58
   <---------ANAC58          <---------KAN1 --------->At4g35610 ------>ZmHOX2a(1)      <---------ANAC58
<<<<<<<TBF1  *TSS     <------ZmHOX2a(1)     --------->ZAT14--------->GLK1(1)      <---------ICU4
 
cttcttccttatcgcgattattggaggagagaatgagttggtctctctgcagcacccatggggtctcctcttccatagctctcacttatggctttcgcca  19670000
                                                                  --------->HSFB2a(1)
                                                                  <---------HSFB2a(1)
                  <-----------ARR10                               <---------KAN1
                  <---------ARR14(2)                             --------->GATA12
                  --------->ARR14(2)                             --------->ARR14(2)
                --------->LBD16                                 --------->ARR14(2)
               <---------ANAC58                                 <---------ARR14(2)
               <---------ANAC46                                 --------->ARR11(2)
               <---------ANAC58                                 <---------GLK1(2)
               <---------ANAC55(1)                             <------NtERF2
               --------->ANAC55(2)                            --------->LBD16
               <---------ANAC55(2)                           --------->RAP2.6(2)
             ------>MYB83                                    --------->LBD16
             ------>MYB46(1)                                 --------->RAP2.3(2)
           --------->AtMYB61                                <------NtERF2
           <---------DOF5.7(1)                              <---------LBD16
           <---------DAG2                                  ------>NtERF2
        <---------ALFIN1                                   --------->MYB52(1)
      <------ZmHOX2a(2)                                   --------->DEAR3(1)
      --------->CCA1(2)                                   --------->ANAC46
     --------->RVE1(2)                                   <---------MYB55(2)
     --------->GATA12                                    --------->DEAR3(2)
     --------->AGP1                <---------ANAC46      --------->MYB46(3)
     <---------GATA12           ----------->HVH21      <---------ARR14(2)
     <---------ARR14(2)     --------->O2               --------->ARR14(2)
     --------->ARR14(2)    ------>NtERF2           <------ZmHOX2a(1)   ------>ZmHOX2a(1)  <---------At4g35610
     <---------ARR11(2)   --------->DEAR3(1)   XXXXXXXXXXXXXXXXXXXX>MIR169H-N             --------->At4g35610
     --------->ARR11(3)   xxxxxxxxxxxxxxxxxxx>smallRNA(le3)--------->LBD16                --------->ZAT14
     <---------ARR11(3)   <---------ALFIN1     XXXXXXXXXXXXXXXXXXXX>MIR169B/C          ------>ZmHOX2a(1)
     --------->ARR11(2)--------->ANAC46       XXXXXXXXXXXXXXXXXXXX>MIR169D-G     ------>ZmHOX2a(1)
   ----------->ARR10 <-----------GT1          XXXXXXXXXXXXXXXXXXXX>MIR169A  <---------DOF5.7(1)    -
 
tagaagaagatccaccttccgtattttcgccacctctgacggattagaacccaaggacgacccgccggaatctcctctcccttcctcatcctctgctctc  19670100
                      <---------DOF5.7(1)
                     <---------DOF5.7(1)
                     <----------DOF2
                    <----------DOF2
                    <---------DOF5.7(1)
                    <---------DAG2
                  ------>NtERF2
                  <------NtERF2
                <-------TEIL
              --------->ARR14(2)       <---------YAB1
            --------->DOF5.7(1)       <---------TOE2(3)                                        <----
           --------->DOF5.7(1) <---------ARR11(3)                                   ------->TEIL <--
           --------->DAG2      <<<<<<<<<<GT-1    <-------GAMYB              --------->YAB1    <-----
          ---------->DOF2<-----------GT1   <---------DOF5.7(1)       --------->AtLEC2         ------
--------->DOF2<---------ARR14(2)     <-----------GT1          <------ZmHOX2a(1)   --------->ZAT18<--
 
ggtaaagacttgaaaaaggtccgccttttttctatatcatttacgatttttctgttgaaaccataggaagacatgaaaatgaaaatgcaccatgttagat  19670200
<- Previous    Next ->

AGI:  At2g48060.1   
Description:  oxidoreductase. similar to unnamed protein product [Vitis vinifera] (GB:CAO68575.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO22459.1); contains InterPro domain Cytochrome b/b6, C-terminal; (InterPro:IPR005798)
Range:  from: 19665165    to: 19669687    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g48070.1   
Description:  similar to unnamed protein product [Vitis vinifera] (GB:CAO22460.1)
Range:  from: 19669914    to: 19671112    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version