AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                          --------->At5g28300
                                                                        <---------TOE2(3)
                                                                   <---------AHL12(2)
                                                                  <---------AHL25(2)
                                                                  <---------AHL25(3)
                                                                  --------->AHL20(1)
                                                                  <---------AHL25(1)
                                                                  --------->AHL25(3)
                                                                  --------->AHL25(2)
                                                                  --------->AHL12(1)
                                                                  --------->AHL25(1)
                            --------->AHL20(1)                    <---------AHL12(3)
                            <---------AHL20(1)                    --------->AHL20(2)
                           --------->AHL12(3)                     <---------AHL12(1)
                           <---------AHL12(3)                     <---------AHL20(2)
                           --------->AHL12(2)                    --------->AHL12(2)
                   --------->RVE1(2)                    <---------YAB1 <---------At5g28300
                   <---------ARR11(2)                 <---------ICU4  --------->MYB52(1)
                   --------->ARR14(2)                --------->ICU4<---------ICU4
                   <---------ARR14(2)              --------->YAB1--------->AHL25(1)
                   --------->ARR11(2)             <---------YAB1 --------->AHL20(2)
                  <---------GLK1(1)         --------->ZAT14      <---------AHL12(3)                -
                  <---------CCA1(2)         <---------ZAT14--------->At4g35610               <------
                --------->YAB1            --------->bZIP60(1)    <---------AHL25(2)     --------->DAG2
<---------REM1(1) --------->KAN1          <---------bZIP60(1)    --------->AHL25(3)    ---------->DOF2
 
aagttgtaactgagttgtatcatatccgatatatattagtatatgacttcactctcattatcagcgaaaaaaattacggtaaacagaccaaaaagtcttt  14840500
                                         <---------KAN1
                                        --------->GATA12
                                        ------->TEIL
                                        --------->RVE1(2)
                                        <---------GATA12
                                        <---------ARR11(1)
                                        --------->ARR14(2)
                                        <---------ARR11(2)
                                        --------->GLK1(2)
                                        --------->ARR11(2)
                                        <---------ARR14(2)
                                       <---------ARR14(1)
                                   --------->At4g35610
                                   ------>NtERF2
                                <---------ZAT2                                         --------->YAB1
                                --------->ZAT2                   --------->YAB1       <---------ATHB12
                                --------->At4g35610             <---------YAB1        --------->ICU4
     --------->YAB5             <---------At4g35610      --------->GLK1(2) --------->ANAC55(2)
-------->ANAC46                --------->ANAC46    <---------ZAT18       <---------ANAC46
----DOF2                   <-----------GT1         --------->ZAT18      <-------TEIL--------->YAB1<-
 
acaaacaatgaccaaaaaaacaatacgattttacaagctgccgaatctacaaattgcactaatctgtatcatagtttcatgtaacaacaatgatgttttt  14840600
                          <---------REM1(1)
                         <---------TOE2(3)
                     --------->WOX13(2)
                     <---------WOX13(2)
                   <---------AHL20(2)
                   <---------YAB1
                  --------->AHL25(3)
                 --------->AHL12(2)                              <---------AHL12(3)
                 <---------AHL12(2)                        <---------AHL20(3)
               <---------AHL12(3)                          --------->AHL25(3)
               --------->AHL12(1)                  ----------->GT1
               <---------AHL12(1)                 --------->ALFIN1
               --------->AHL25(2)               <---------ANAC46 --------->AHL12(3)    <---------AHL12(1)
              --------->AHL25(2)                <---------ZAT6   <---------AHL12(2)    <---------AHL25(2)
              --------->AHL12(2)                --------->ALFIN1<---------AHL20(1)     --------->AHL12(1)
              <---------AHL25(2)              <---------ANAC46  --------->AHL20(1)    --------->AHL25(3)
              <---------AHL12(2)            <---------ZAT14<---------AHL25(1)        --------->AHL12(2)
              --------->AHL12(1)     --------->AHL25(2)    --------->AHL25(2)        <---------AHL12(3)
              <---------AHL12(1)     <---------AHL25(2)    --------->AHL25(1)        --------->AHL12(3)
             --------->AHL12(1)      --------->AHL20(2)    --------->AHL20(3)        --------->AHL20(3)
             <---------AHL12(1)      <---------AHL12(3)    <---------AHL20(2)        <---------AHL20(3)
        --------->YAB1<---------WOX13(1)    --------->ZAT14--------->AHL20(2)        --------->AHL25(1)
--------RVE1(2)--------->AHL12(3)    <---------AHL25(1)    <---------AHL12(3)   ----------->GT1
 
agagtttctaataagaaaatttttaattgatgtaacaaaaaaaaatgtgtagtgtgggaaattttaatatatatcagtgagtttagataaaaatttgaaa  14840700
                                                      --------->GLK1(1)
                                                      <---------KAN1
                                                      --------->CCA1(2)
                                                      <----------TaMYB80
                                                      <---------GLK1(1)
                                <---------YAB5        --------->KAN1
                             --------->ICU4          <---------ARR11(2)           <---------AHL25(1)
                        --------->ANAC58             --------->ARR11(2)           <---------YAB1
                        <---------ANAC55(2)          <---------RVE1(2)            <---------AHL20(2)
                        --------->ANAC58             --------->ARR14(2)         <---------KAN1
                        --------->ANAC46  --------->RVE1(2)                --------->ANAC58   ------
                        --------->ANAC55(2)         =====================HOX2a_HOX2a       ---------
                   <-----------GT1        --------->GATA12        ----------->GT1 --------->AHL25(1)
                --------->WOX13(2)        <---------GATA12        ------>ZmHOX2a(2)        ---------
                <---------WOX13(2)   ----------->GT1<------ZmHOX2a(1)      --------->ANAC58<--------
       --------->YAB5   --------->bZIP60(2)       <---------TOE2(3)   --------->YAB1  <---------LBD16
  <---------WOX13(2)    --------->ANAC55(1)     ---------->DOF2 --------->ARR11(2)--------->AHL20(2)
  --------->WOX13(2) --------->MYB46(3)  <---------CCA1(2)      <---------ARR11(2)--------->AHL12(3)
 <-----------GT1--------->AHL12(2)   <---------ANAC46<---------ARR14(2)  <---------ICU4    <--------
 
gttttaactacaattactaaattaaccacgtaatagtgagtcgtaaatctacaaaggatatgcgagggatcgataatcaaggcatataattcggagctga  14840800
                                 <---------TOE1(3)
                              --------->ARR11(2)
                              <---------ARR11(2)
                              --------->ARR14(2)              <---------YAB1       --------->YAB5
   <---------TOE1(3)          <---------MYB52(1)            --------->KAN1        <---------AHL20(2)
--->At4g35610 <---------WOX13(2) <---------YAB1           <---------ANAC58    <---------AHL20(2)
>At4g35610   --------->MYB52(2)  <---------TOE2(3)        <---------ANAC58  <----------DOF2
>ZAT2      <---------MYB52(1) <---------ARR14(2)        <---------PCF2     --------->YAB5         <-
-ZAT2 <----------DOF2      <---------TOE2(3)         --------->ALFIN1      <---------ICU4      -----
-At4g35610--------->WOX13(2) <-------GAMYB     <---------At4g35610        <---------YAB5  ----------
 
tgagttaagctttagttagtttgactaactacggttatggttaagacttaagcagagtggggcttattagtggattaatctttatttgattactccaata  14840900
                                                <-------TEIL
                                               --------->GLK1(2)
                                              --------->GATA12                              <-------
                                        --------->At4g35610                                 <-------
    <----------DOF2                    --------->MYB52(1)                                   <-------
   --------->TOE2(3)                --------->ANAC58                                    <---------KAN1
--------AHL20(2)           ------>ZmHOX2a(1)  <---------GATA12                         --------->ARR14(2)
---->YAB1       <---------CCA1(2)   --------->ANAC46     --------->ANAC58              <---------ARR14(2)
-->CBF<---------CCA1(2)   *TSS      --------->ANAC58     --------->ANAC58              ------->TEIL
 
ttaaaacctttatctctccatctctctctccttcacaacaagcaactgagattcagagacaagaaaatgcaacgcgagaaaactcaaacgaatttgcgtt  14841000
                                                                            <---------ICU4
                                                                           --------->ICU4
                                                                           <---------YAB1
                                       --------->ANAC58                    ------>ZmHOX2a(1)
                                       --------->ANAC58          <---------MYB52(1)
                          --------->KAN1                        --------->LBD16
               <---------ANAC46   --------->ANAC58             <---------DEAR3(1)          ---------
              <------NtERF2       --------->ANAC58             <---------DREB2C(2)         ---------
      --------->ALFIN1    --------->GLK1(1)                   <---------LBD16             ------->TEIL
     <------ZmHOX2a(1)   <---------ARR11(2)                   <---------ANAC46         <---------MYB52(2)
    --------->DOF5.7(1)  <---------ARR14(2)                   <---------ANAC58         --------->ANAC58
--ANAC58   <------NtERF2 --------->ARR14(2)                   <---------ANAC58     ------>NtERF2
--ANAC46   --------->ATERF1(1)    --------->ANAC46        <-------GAMYB ---------->ID1 --------->ANAC46
--ANAC58<------ZmHOX2a(1)--------->ARR11(2)     <---------MYB52(1) <---------MYB46(3)  --------->ANAC58
 
tggacgaaggaggaggcagcgtttggcagaaatgctcaagacacgaaggtcgttttgtctgcgttgccggtgtttgtccttattgcctccacgaacgcct  14841100
                                                    <------NtERF2
                                                    --------->DEAR4(2)
                                                    --------->ATERF1(1)
                                                   ------>NtERF2
                                                   <---------ATERF1(1)
                                                  --------->ANAC58
                                        --------->ZAT14  --------->LBD16
                                        <---------ZAT14 <---------ANAC58
                                        <---------ZAT18 <---------ANAC58
                           ------>ZmHOX2a(2)      --------->ANAC46
                          <------ZmHOX2a(2)       --------->ANAC58
                         --------->ARR14(3)      <-------MYC3
                         --------->ARR11(3)      ------->MYC3                   <---------O2
                         <---------ARR14(3)      ------->MYC2                   <---------ANAC58
                         <---------GATA12        <-------MYC2                   <---------bZIP60(2)
                         --------->GATA12        ------->PIF5<---------ANAC58   <---------ANAC46
                         <-----------ARR10       <-------PIF5<---------ANAC58   <---------ANAC58<---
                         --------->ARR14(2)     --------->ANAC58             ----------->TGA1   ----
                         <---------ARR14(2)     --------->ANAC58     --------->REM1(2)      --------
                         <---------ARR11(3)--------->ANAC46<-----------ARR10 ----------->HVH21  <---
=================================HOX2a_HOX2a    --------->ANAC46    --------->ALFIN1   <---------MYB52(1)
==================================HOX2a_HOX2a <---------ALFIN1    <---------ANAC46   <---------ANAC58
------>ZmHOX2a(1) <---------ZAT18    <---------ANAC46   <---------ANAC46  --------->DAG2--------->SPL7(1)
>ANAC58           <---------At4g35610<---------ANAC58 ------>NtERF2--------->LBD16   <---------ANAC58
>ANAC58           --------->At4g35610<---------ANAC58--------->DEAR3(1)   --------->DOF5.7(1)   ----
 
ctcctctctctgtcccgattgtgctcacgatcttccctgttcgtgtactccacgcgcctccgtgtcttcccgtggagaaggtgacgtttcgttcgcccgt  14841200
             --------->ALFIN1
           <---------ANAC58
           <---------ANAC46
           <---------ANAC58
        <------MYB83
        <------MYB46(1)
      <--------P
      <---------MYB52(1)                              --------->ETT(2)
     <-------GAMYB                                    <---------ETT(2)
    <---------DEAR3(2)                            <---------AtMYB61
    <------MYB46(1)                            <---------ANAC46                                    -
    <---------MYB46(3)                       --------->ARR11(2)          ------>ZmHOX2a(1)        --
    --------->MYB55(2)                     <----------DOF2        <---------ANAC55(2)             <-
    <------MYB83                          <---------ANAC58        --------->ANAC55(2)           ----
   <---------DEAR3(1)                   --------->LBD16           <---------ANAC55(1)           <---
 <-----------HVH21                     --------->DEAR3(1)         <---------ANAC58              <---
------ARR14(2)                        --------->MYB46(3)          <---------ANAC46              ----
----->ARR11(2)             <---------WOX13(1)<---------ARR11(2)   <---------ANAC58            ------
--------->AGL1           --------->ATHB12 <---------ANAC58       <---------LBD16      <---------At4g35610
------ARR11(2)          <---------YAB1--------->DEAR3(2)     --------->YAB5           --------->At4g35610
----->ARR14(2)--------->REM1(2)      --------->MYB52(1)<---------DDF1    --------->ICU4     <-------
 
attgggtcggttggccgtgttgccaacttgattgaatgcgaaccggcgtttcggaggtcgacatcgattacgggtccttatttctggtctgctaaaccgg  14841300
                                  <---------ANAC46
                                  <---------ANAC58
                                  <---------ANAC58
                                  <---------MYB46(3)
                                 --------->ALFIN1
                                <-----------HVH21
                              --------->LBD16
                            <---------LBD16
                      ------>ZmHOX2a(2)
  --------->KAN1     <------ZmHOX2a(2)
-------------->AGL15<---------GATA12                                                             ---
--------------->AGL3<---------ARR11(3)                                                           <--
----------------AGL3<---------ARR14(2)                                                      --------
----->ARR11(2)      --------->GATA12                                                      --------->MYB52(1)
------ARR11(2)      --------->ARR14(2)                            <---------ARR11(2)      ----------
------ARR14(2)      --------->ARR11(3)                        <---------At4g35610  --------->ANAC58
----->ARR14(2)     <------ZmHOX2a(1)                <---------RVE1(2)              ----------->GT1
--->LBD16         --------->HSFC1(2)          <---------RVE1(2)  <------ZmHOX2a(1) --------->ANAC58
--LBD16           <---------HSFC1(2)      <---------MYB52(1)  --------->At4g35610--------->CCA1(2)
 
aaccgatattagaaactgagaaggatcttaaaccgggtcgtggacgttggctatggagattgttcagaggaaacagagaagaagagacgaaaataaaggc  14841400
<- Previous    Next ->

AGI:  At2g35200.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G32690.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO63405.1)
Range:  from: 14840927    to: 14841703    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version