AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                   -
                             <-----------GT1                                                   -----
                          <---------ARR14(2)   <---------HSFB2a(2)                             <----
                          <---------GLK1(2)    --------->HSFB2a(2)                             -----
                          <---------GATA12  ------->TEIL                                       -----
                          <---------RVE1(2)<---------KAN1             <---------ARR11(1)       -----
                          *TSS         <---------ANAC58               --------->RVE1(2)        <----
                          --------->ARR11(3)--------->ARR14(2)        --------->ARR14(2)      ------
                          --------->ARR14(2)<---------ARR11(2)        <---------ARR11(3)      ------
                          --------->GATA12 <---------CCA1(2)         <---------CCA1(2)        ------
                          <---------ARR11(3)<---------ARR14(2)--------->ARR11(2)          --------->AHL20(2)
                    --------->ZAT18    <---------ANAC46       <---------ARR11(2)       --------->TOE2(3)
               ---------->DOF2   <----------DOF2              <---------ARR14(2)       ----------->GT1
     ---------->DOF2<---------ZAT14    <---------ANAC58       --------->ARR14(2)      ----------->GT1
 
attgaagtaaaagctcatcaaagtccacagattttccttttagcgtgtatctcgaactcgaagacgatacccatatctatttctactaaatgttaaaata  13932500
                                                                             --------->ZAT2
                                                                             --------->At4g35610
                                                                         <-----------GT1
                                                                     <---------WOX13(2)
                                                                     --------->WOX13(2)
                                                                    <---------AHL20(2)
                                                                    --------->AHL12(3)
                                                                    --------->AHL25(2)
                                                                    <---------AHL25(3)
                                                                    <---------AHL12(2)
                                                                    <---------AHL25(1)
                                                                   --------->AHL25(1)
                                                                   <---------AHL25(1)
                                                                   --------->AHL25(3)
                                                                   <---------AHL12(3)
                                                                   <---------AHL25(2)
                                                                   --------->AHL12(1)
                                                                   <---------AHL12(1)
                                                                   --------->AHL25(2)
                                                                   --------->AHL20(2)
                                                                   --------->AHL12(3)
                                                                   <---------AHL25(3)
                                                                   <---------AHL20(2)
                                                                   <---------AHL20(1)
                                                                  --------->AHL12(3)
                                                                  <---------AHL20(2)
                                            --------->TOE1(3)     <---------AHL12(3)
                                            --------->TOE2(3)     <---------AHL25(2)
                                        <---------AHL25(3)        --------->AHL20(3)
                                        <---------AHL20(2)        --------->AHL25(3)
                                        <---------AHL25(1)        <---------AHL20(3)
                                        --------->AHL20(2)        <---------AHL25(1)
                                        --------->AHL25(1)       <---------AHL12(2)
                                       <---------AHL12(2)        <---------WOX13(2)
                                      --------->WOX13(2)         --------->WOX13(2)
                                    <---------AHL25(3)           --------->AHL12(2)
                                    <---------AHL20(3)          <---------AHL12(2)
                                    --------->AHL25(1)         --------->AHL20(2)
                                    --------->AHL12(3)         --------->AHL20(3)
                                    <---------AHL20(2)         <---------AHL20(2)
                                    --------->AHL20(3)         --------->AHL25(1)
                                    --------->AHL20(2)         <---------AHL20(1)
                                    <---------AHL12(3)         --------->AHL20(1)
                                    --------->AHL25(2)         <---------AHL20(3)
                                   --------->AHL25(2)          <---------AHL25(1)
                                   --------->AHL20(1)          <---------AHL25(2)
     --------->TOE2(3)             <---------AHL25(3)          <---------AHL12(1)
     --------->YAB5                <---------AHL25(2)          <---------AHL25(3)
-------->LBD16                     <---------AHL20(1)          --------->AHL25(3)
---->ARR11(2)                      <---------AHL20(2)          --------->AHL25(2)
-----ARR14(2)                      --------->AHL20(2)          --------->AHL12(1)
---->ARR11(3)                      --------->AHL25(1)         --------->AHL25(3)               -----
---->ARR14(2)                      <---------AHL25(1)        <---------AHL12(2)                -----
---->RVE1(2)       ----------->RAV1(1)<---------WOX13(2)     --------->AHL12(2) --------->At5g28300-
-----ARR11(3)    --------->ZAT18   --------->AHL25(3)       --------->YAB1   <---------At4g35610   <
--->RVE1(1)  --------->DOF5.7(1)   --------->AHL12(3)      --------->AHL20(2)<---------ZAT2    -----
--->KAN1  <---------YAB1           <---------AHL12(3)------->GAMYB--------->AHL20(2)         -------
--->CCA1(1) ---------->DOF2     --------->YAB1   --------->MYB46(3)--------->AHL20(1)       <-------
 
tccccaaacgtttataaaagtgcaacatagcccaaaaataaaattaaacttaacaacagcaaataataaattaatttcacagctgtaacttgagaataac  13932600
                               --------->ARR11(2)
                     =====================HOX2a_HOX2a
                    ======================HOX2a_HOX2a
                    <------ZmHOX2a(2)
                    --------->CCA1(2)
                   <---------GATA12
          ----------->RAV1(1)  <---------ARR14(2)
       --------->ANAC58        --------->ARR14(2)
   --------->WOX13(2)===================================HOX2a_HOX2a
   <---------WOX13(2)------>ZmHOX2a(2)                        --------->ARR11(3)
   <---------TOE2(3)====================================HOX2a_HOX2a
 <---------AHL20(2)--------->GATA12<---------YAB1           <---------YAB5
 --------->AHL20(2)<-----------ARR10         --------->ARR14(2)
 --------->AHL25(1)<---------ARR14(2)        <---------ARR14(2)
--------->ICU4     --------->ARR11(3)        --------->ARR11(3)
<---------ATHB12   <---------ARR11(3)        --------->RVE1(2)<---------RVE1(2)
---->ANAC58        --------->ARR14(2)        <---------ARR11(3)
---->ANAC46        --------->AGP1  ------>ZmHOX2a(1)    <---------RVE1(2)
-------->WOX13(2)  <---------AGP1 --------->TOE2(3)     <---------GLK1(2)           <---------ANAC58
---------WOX13(2)  --------->RVE1(2)<---------ICU4     <---------At4g35610          <---------ANAC58
---->ANAC58 --------->REM1(1)  <---------ARR11(2)  <-----------HVH21         --------->DAG2
-->MYB52(1) --------->MYB46(3) ------->TEIL --------->KAN1  <---------YAB1  ---------->DOF2
--KAN1 --------->ANAC58       <---------CCA1(2)  ------>ZmHOX2a(1)        <---------RVE1(2)  -------
 
gcaattaatgaagcaacaacaagatctatgtgtgtatccttattgcaatatcctggtcagattatgattttgttttggataaagtttccttggctcaaaa  13932700
                                                  --------->RVE1(2)
                                               <---------AHL12(2)                                 --
                                              <---------AHL20(2)                       ---------->DOF2
                                <---------------AtSPL3                             --------->RVE1(2)
                                <---------------AtSPL8                            <---------GLK1(1)
                        ---------->DOF2      --------->AHL20(2)                   --------->GLK1(1)
                <----------DOF2 --------->HSFB2a(2)                               --------->KAN1<---
                <---------DOF5.7(1) <---------TOE1(2)                            <---------RVE1(2)<-
--->DOF2     <-----------GT1    <---------HSFB2a(2)                     ------>ZmHOX2a(1)     <-----
 
gtaaacttccttctatttccttttctctaaagtttctagtacgttctatataatatccaatacctctctaacttcctattttgtgatatccaaagttctg  13932800
                                                                                               <----
                                                                                               =====
                                                                                              ------
                                                                                              <-----
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
            ------->GAMYB                                                                     ------
           --------->MYB46(3)                                                                 <-----
      --------->TOE2(3)                >>>>>>>>>TBF1                                          <-----
      --------->TOE1(3)               xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)                   ------
     --------->ZAT6                 >>>>>>>>>TBF1  >>>>>>>>>TBF1                              <-----
   <-----------GT1               >>>>>>>>>TBF1  >>>>>>>>>TBF1                                 ------
<---------AHL12(2)            >>>>>>>>>TBF1  >>>>>>>>>TBF1                                    <-----
------->AHL12(1)             xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3) <---------YAB1  ------->GAMYB----
------RVE1(2) <------ZmHOX2a(2) xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)<------------CBF        *TSS
--------AHL12(1)  <---------ALFIN1 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3) <---------YAB1     --------
----YAB1 --------->MYB52(1)>>>>>>>>>TBF1  >>>>>>>>>TBF1--------->DOF5.7(1)      ----------->RAV1(1)<
 
attttttaaccctaacgatcaacacttgaagaagaagaagaagaagaagaagaagaagaagatggtgatgaagattgcgatagcaacagagagaacagat  13932900
       <------MYB83
       <------MYB46(1)
      --------->MYB59
      --------->MYB46(2)
     <---------MYB55(1)
    <---------MYB52(1)
 ------>ZmHOX2a(1)
--------------->AGL15
--ZmHOX2a(2)
========HOX2a_HOX2a
--->ARR14(3)
------ARR10
----GLK1(2)
--->AGP1
----ARR14(3)
--->ARR11(2)
----ARR11(2)
--->ARR11(3)
----RVE1(2)
----GATA12
--->GATA12
----ARR14(2)                     --------->WOX13(2)              <----------DOF2
--->ARR14(2)             <---------RVE1(2)                      <---------ANAC46
----ARR11(3)        --------->WOX13(2)                          <---------ANAC58
-->ZmHOX2a(2)       <---------WOX13(2)      --------->YAB5      <---------ANAC58                 <--
--->ARR10 --------->ARR11(2)    --------->KAN1 <---------At4g35610   <---------RVE1(2)          ----
-----------------AGL1 --------->YAB1       <---------KAN1 ------->TEIL         <---------RVE1(2)----
 
cttcctcgtttggtatctactgcaattagagcttctaattcgcagaatgcttctgatgttgaacgttgctttgatgttcttcgatacttgaagggtttga  13933000
                                                                                          --------->ANAC58
                                                                                          <---------ANAC55(2)
                                                                                          <---------TGA1a
                                                                                          --------->ANAC55(2)
                                                                                          --------->TGA1a
                                                                                          --------->ANAC58
                                                                                     <---------At4g35610
                                                                           <-----------------------TaNAC69(2)
                                                                         --------->ARR14(2)
                                                                         <---------ARR14(2)
                                                                         --------->ARR11(2)
                                                                         --------->ARR11(1)
                                                                         <---------ARR11(2)
                                                                         <---------RVE1(2)==========
                                                            <---------ANAC55(2)      --------->At4g35610
           --------->ARR11(3)                               --------->ANAC58    --------->ANAC58
           <-----------ARR10                                --------->ANAC46    --------->ANAC58
      <<<<<<<<<WRKY18                                       --------->ANAC58  --------->MYB52(1)
    <-----------HVH21                                    <------ZmHOX2a(2) <-------TEIL   --------->O2
-------KAN1<---------ARR11(3)                           --------->ARR11(3)--------->CCA1(2)
--->TEIL   --------->GLK1(2)   <---------RVE1(2)        <---------ARR11(3)--------->ARR14(1)      <-
----->GATA12             ---------->DOF2       --------->GLK1(2)       ----------->ARR10  <---------O2
 
atctctctgtcaaaaatctttcccattccaaagtgatacttcccttggagagtctgagagatcacgaaaaccctaagatacgaacggaagctcacgtctt  13933100
                                                                      ----------->HVH21
                                                                     --------->LBD16
                                                                    ----------->RAV1(2)
                                                                    <---------LBD16
                                                               ------>MYB46(1)
                               ------>NtERF2                   ------>MYB83
                              <---------ZAT18                <---------MYB59
                            --------->At4g35610              --------->TOE2(3)                <-----
                            <---------At4g35610          ------->GAMYB--------->LBD16         <-----
                     <-----------GT1                    <---------MYB52(2)                    <-----
                  <---------DOF5.7(1)                   --------->MYB46(3)                ----------
============================bZIP_DOF                  ----------->RAV1(1)        ---------->DOF2----
--------ZAT18    <----------DOF2                      ==========================RAV   ----------->GT1
 
gttcacttcatggatgaagactttttactccagcggacaaaactcttcttctacttgcaacaaacctaatcccctgaaactgaagaaagttgttaaagcg  13933200
----ANAC58
----ANAC46                                                      --------->DOF5.7(1)
----ANAC58                                  <---------LBD16   ---------->DOF2
>DOF2      >>>>>>>>>TBF1       --------->RVE1(2)      <---------TOE2(3)                  >>>>>>>>>TBF1
----->ALFIN1  >>>>>>>>>TBF1  <---------MYB52(2)       <---------TOE1(3)        <---------LBD16
 
tgttcggagttgaagaagaagaacgaagagcaactatctcatggttttgcggtacttaaggctaagaaagagactgtttttttggggatgaagaagaacg  13933300
               <-------TEIL
        ------>ZmHOX2a(2)
       <------ZmHOX2a(2)
       --------->CCA1(2)
      --------->GATA12
      <---------ARR11(3)
      >>>>>>>>>GATA-2
      --------->AGP1
      --------->ARR11(3)
      >>>>>>>>>GATA-1
      >>>>>>>>>GATA-3                                                                    --------->ANAC58
      >>>>>>>>>GATA-4                                             --------->YAB1     >>>>>>>>>TBF1
      <---------GATA12                        --------->KAN1     --------->ICU4<---------HSFB2a(2)
      <---------RVE1(2)       --------->At4g35610             <---------AtLEC2 --------->HSFB2a(2)
     --------->GLK1(1)        --------->CCA1(2)          <----------DOF2<------ZmHOX2a(1)--------->ANAC58
 
aagatgagagatctagggttcatgaaaccagagagatgaaacaaattggtgattccaagtcttttgcattgatgaggactatcgagaagaagaagcaatc  13933400
<- Previous    Next ->

AGI:  At2g32810.1   
Description:  BGAL9 (BETA GALACTOSIDASE 9); beta-galactosidase. Identical to Beta-galactosidase 9 precursor (BGAL9) [Arabidopsis Thaliana] (GB:Q9SCV3;GB:O48836); similar to BGAL8 (BETA-GALACTOSIDASE 8), beta-galactosidase [Arabidopsis thaliana] (TAIR:AT2G28470.1); similar to BGAL1 (BETA GALACTOSIDASE 1), beta-galactosidase [Arabidopsis thaliana] (TAIR:AT3G13750.1); similar to BGAL3 (beta-galactosidase 3), beta-galactosidase [Arabidopsis thaliana] (TAIR:AT4G36360.1); similar to putative beta-galactosidase [Glycine max] (GB:AAQ62586.1); similar to beta-D-galactosidase [Pyrus pyrifolia] (GB:BAD91079.1); similar to pear beta-galactosidase3 [Pyrus communis] (G
Range:  from: 13926204    to: 13932427    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g32820.1   
Description:  DNA binding / protein binding / transcription regulator. similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G33090.1); similar to hypothetical protein 27.t00083 [Brassica oleracea] (GB:ABD65077.1); contains InterPro domain Transcription elongation factor, TFIIS/elongin A/CRSP70, N-terminal; (InterPro:IPR010990); contains InterPro domain Transcription elongation factor, TFIIS/CRSP70, N-terminal, sub-type; (InterPro:IPR003617)
Range:  from: 13932894    to: 13934056    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version