AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                               --------->ARR11(3)
                                                               <---------ARR11(3)
                                                              --------->RVE1(1)
                                                              --------->GLK1(1)
                                                              <---------GLK1(1)               <-----
            <---------DAG2                                    --------->CCA1(1)      <---------MYB52(1)
            <---------DOF5.7(1)               <----------DOF2--------->ARR11(3)      <---------ARR14(2)
          ------->TEIL                     <---------------AGL15                    <---------RAP2.6(3)
 --------->ARR11(2)               <----------DOF2 <---------ANAC46                 <---------ANAC58
 <---------ARR11(2) --------->ANAC58       --------------->AGL15     <---------CCA1(2)      <-------
<---------CCA1(2)   --------->ANAC58 --------->YAB1          <---------ARR11(3)    <---------ANAC58
 
tttgtatcccttgaacctttcccaagcttcacaaaaactttcattactcctttgagtgaagctagatatctcatttctcaaccttgccgttcttgttgtg  5495500
                                                             <---------GLK1(2)
                                                             <---------RVE1(2)
                                                            --------->KAN1             ------>ZmHOX2a(2)
                <---------HSFC1(2)                         ----------->ARR10         <---------GATA12
                --------->HSFB2a(1)                    <---------TOE1(3)             --------->ARR14(2)
     <----------DOF2         <---------AtMYB61         <---------TOE2(3)             <---------ARR11(3)
  --------->ARR11(3) <----------DOF2               <-------GAMYB                     --------->GATA12
  <---------ARR11(3)<---------DOF5.7(1)      <---------REM1(1)                  --------->ZAT2     -
----ANAC46      <---------HSFB2a(1)       ----------->HVH21<-------TEIL   <---------ARR14(2)      --
--ANAC46     <------ZmHOX2a(1)            --------->ALFIN1<--------P      --------->ARR14(2)      --
 
gagaagaactttgagaggaaggctcttttgcattggtcccaagaggtgatggagcgttgaggtagattcttctcccaaatacgagctcgatctccaagag  5495600
                                           <---------RVE1(2)
                                   <------ZmHOX2a(2)
                                  --------->ARR11(3)
                                  --------->GATA12
                                  <---------ARR14(2)
                                  <---------ARR11(3)                                         -------
                                  --------->ARR14(2)                                  ==============
                                  <---------GATA12                                    ------>ZmHOX2a(2)
                                 --------->GLK1(1)                            <---------HSFC1(1)
                                 <---------GLK1(1)          --------->ANAC46  <---------HSFB2a(2)
                                 --------->KAN1     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)---------->DOF2
                               --------->LBD16   <---------At5g28300          >>>>>>>ZML2 --------->DOF5.7(1)
-------->DOF5.7(1)       <---------At4g35610    <-----------GT1   --------->RVE1(2) <---------GATA12
------->DOF5.7(1)        <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)----------->RAV1(1)    --------->RVE1(2)
------->MYB52(1)        ------->TEIL------>ZmHOX2a(2)     --------->ANAC46    --------->HSFB2a(2)---
 
aaaacgggaagagtctaagtttgaatgcatcttccgagatcccattgattttcaccgtgctacacaacatatcaaattgttctagatgatccaaagggtc  5495700
                                                           ---------->DOF2
                                                        --------->TOE2(3)
                                                    --------->AHL25(1)
                                                    <---------AHL25(3)
                                                    <---------AHL25(1)
                                                    <---------AHL20(2)
                                                   --------->AHL20(2)
                                                --------->ATHB12
   --------->YAB1                            <---------ANAC58                 --------->LBD16
-->ARR14(2)                   xxxxxxxxxxxxxxxxxxxx>smallRNA(se3)             ------->GAMYB
====HOX2a_HOX2a              <-----------GT1 <---------ANAC58   <---------MYB46(3)<------ZmHOX2a(1)
--->ZmHOX2a(1)        <---------TOE2(3) <XXXXXXXXXXXXXXXXXXXXMIR843         <---------LBD16     <---
 
ctccattgataaaccatggaacttagaggtttgaaccatgttgatgaggcttgatttaatctcaaagttgttgttctcaaccggaggagcttgaataccg  5495800
                    <-------TEIL
                 <------MYB83
                 <------MYB46(1)                                        <-----------GT1
             --------->ATHB12                          <--------P    --------->At4g35610
            <---------KAN1                             <---------WOX13(1)    ------>MYB83
        --------->ANAC58                       <---------ZAT18       <---------KAN1
        --------->ANAC46                       --------->ZAT18       <---------At4g35610
        --------->ANAC58                 <---------MYB46(3)<-----------RAV1(1)         <---------ANAC58
       --------->LBD16                  <--------P    <-------GAMYB<---------ANAC46    <---------ANAC58
       <---------LBD16   ---------->DOF2<---------WOX13(1)<---------TOE2(3)  ------>MYB46(1)
------MYB52(1)  --------->MYB59       <---------MYB46(3)  <---------RVE1(2)--------->AtMYB61     <--
 
tttctatttccacggatgtttggttcatcaaaggctccaattggttgatgagcacttggttgatgttgtggcatatgaccatccctattagcttggccat  5495900
                 <---------ANAC46       ------->GAMYB
             <---------ZAT2          --------->MYB52(1)
             --------->ZAT2          <---------ARR14(2)
            <---------ALFIN1         --------->ARR11(2)
           <---------ALFIN1          --------->ARR14(2)
          <------NtERF2             <---------KAN1
         --------->ANAC58    ----------->HVH21
         <------NtERF2       ----------->TGA1                                               <-------
         --------->ANAC58  <---------ICU4  <---------ZAT2                             <---------ARR14(2)
       --------->PCF5      --------->YAB1  --------->ZAT2                             --------->ARR14(2)
  --------->ATHB51--------->LBD16*TSS<---------ARR11(2)                            <---------ANAC58
  <---------ICU4<---------LBD16 <---------ANAC46                                   <---------ANAC58
---------------AGL1   <-------TEIL  --------->KAN1                            <----------DOF2      -
 
ttccattatggcccccaactccgggttcattcatgacgcataaccgagcaaggtgttcaagtcgttctcgttctcttcttgctctagcgttttctctttc  5496000
                                                       <-------TEIL
                                                    <---------DEAR3(2)
                                          ----------->HVH21
                                          <---------MYB52(1)
               --------->GATA12           <xxxxxxxxxxxxxxxxsmallRNA(i)
               ------->TEIL              --------->At5g28300
          <---------ANAC46              <---------ANAC58
          <---------ANAC58              <---------ANAC58
          ----------->GT1              <---------DEAR3(1)
          <---------ANAC58            ------>NtERF2 <------MYB83<----------DOF2             --------
      <---------GATA12               xxxxxxxxxxxxxxxx>smallRNA(i)                        --------->YAB1
      --------->GATA12            <---------ANAC58  <------MYB46(1)                 <-------TEIL<---
 --------->MYB52(1)          xxxxxxxxxxxxxxxx>smallRNA(i)   <---------ALFIN1       --------->CCA1(2)
---DOF2<---------KAN1       <---------TOE2(3)      <---------TOE2(2)             --------->YAB5 ----
--------->DOF2<---------CCA1(2)   <---------ANAC58 <---------TOE1(2)            --------->ICU4<-----
 
aaacaagcggatgtcgtgaatctcttctactaagtttgctcggccgtgacttcgtaggttcatacacctttaaaacaagagcaaagattcaagtataaag  5496100
                                                                               <------NtERF2
                                                                              ------>NtERF2
                                                                             --------->DEAR3(1)
                                                                            --------->RAP2.3(1)
                                                                           ------->GAMYB
                                                                           <---------ATERF1(1)
                                                                           <---------RAP2.3(1)
                                       <---------GLK1(1)  <---------ICU4  <---------DEAR3(1)     <--
                                       --------->GLK1(1) <---------YAB1 <---------ATERF1(1)      <--
        <---------TOE2(3)        --------->ARR14(2)    <-----------GT1  --------->MYB52(1)       ---
     <---------MYB52(2)          <---------ARR14(2)    --------->YAB5  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
----------->GT1             --------->ANAC58 <---------ICU4          --------->LBD16             ---
-->DOF2---------->DOF2      --------->ANAC58 --------->MYB52(1)    --------->DEAR3(2)            ---
---ZmHOX2a(1) --------->DOF5.7(1)--------->ICU4        <---------ICU4--------->ANAC46           ----
----->YAB5   --------->DOF5.7(1)<xxxxxxxxxxxxxxxxsmallRNA(i)       --------->RAP2.6(3)  <---------REM1(1)
----TOE2(3)  ---------->DOF2--------->ANAC46------>ZmHOX2a(1)     --------->MYB52(1)   <---------TOE2(3)
 
gattagtaactaaagtaaaaggcttagtctcaagcaaatatgaaatcctaatggctaataactattgcaaaccggcaacggcgccaaattgatgtagcat  5496200
          -------->HAHB4
         <---------YAB5
         --------->ICU4
        <---------WOX13(2)
        --------->AHL12(2)
        <---------AHL12(2)
        --------->WOX13(2)
       <---------AHL25(3)
      --------->AHL12(1)
      <---------AHL12(1)
      --------->AHL20(2)
      --------->AHL20(1)
      --------->AHL20(3)
      <---------AHL20(1)
      --------->AHL25(1)               ------->GAMYB
      <---------AHL25(1)              <---------MYB52(2)
      <---------AHL25(3)          <---------YAB5
      --------->AHL25(3)         --------->WOX13(2)
      --------->AHL25(2)        --------->WOX13(1)
      <---------AHL20(2)       <---------AHL12(1)                                        <---------ANAC46
     --------->AHL25(3)        --------->AHL12(1)                                        <---------ANAC58
    --------->WOX13(2)         --------->AHL20(2)                                        <---------ANAC58
    <---------WOX13(2)         --------->AHL25(1)                                    <----------DOF2
   --------->WOX13(1)          <---------AHL20(2)                              ----------->GT1   xxx
-------AHL25(1)              --------->WOX13(2)                               --------->DOF5.7(1)---
-------AHL20(2)              <---------WOX13(2)                               <---------TOE2(3)  ---
------>AHL25(1)            <---------YAB1                                  <---------WOX13(2)    <--
------>AHL12(3)          <-----------GT1                         xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(s2)
------>AHL20(2)       --------->WOX13(2)             --------->ANAC46  <---------At4g35610 <--------
----->AHL25(3)   --------->MYB46(3)  --------->At4g35610     --------->TOE2(3)--------->DAG2    <---
 
ttatttcaattaattatcgaaccacaatttacaattaatcaactcaccaagaatacacaaaatttcttaatctaagctaataaggtgactttgagtgttc  5496300
                               --------->AtLEC2
 --------->TOE2(3)        --------->ANAC58                                                         -
 --------->YAB1           --------->ANAC58             --------->ANAC58                            <
xxxxxxxxxxxxxxxxxxxx>smallRNA(s2)                  --------->ANAC58                            <<<<<
--->ZmHOX2a(1)        --------->AtLEC2             --------->ANAC58                           ------
------------>AGL15    --------->ANAC58           ---------->DOF2                              ------
-------------AGL15   --------->WOX13(1)      ---------->DOF2    --------->DOF5.7(1)        ---------
-ZAT6  <-----------GT1--------->ANAC58     --------->CCA1(2)  ---------->DOF2            ---------->DOF2
------MYB59       --------->RVE1(2)     ----------->GT1--------->ANAC58         ---------->DOF2-----
 
ctaatcttagtaacaatgcattatcaagcaaacaatgcaaaacaagataaaagaaagcaagaaacaaaagactaacaagtttcgaaagtaaacaaagcgg  5496400
<- Previous    Next ->

AGI:  At2g13260.1   
Description:  transposable element gene. gypsy-like retrotransposon family (Athila), has a 1.1e-121 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana)
Range:  from: 5493497    to: 5495934    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version