AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                     <---------RVE1(2)                 <---------MYB52(1)
                                     <---------GATA12                <---------ANAC58
                                     --------->GATA12                <---------ANAC46
                                     --------->ARR14(2)              <---------ANAC58
                                     <---------ARR14(2)            ------>MYB83           --------->ANAC58
                                     <---------ARR11(2)            --------->MYB52(1)     --------->ANAC58
                                     --------->AGP1                -------->P <---------------AGL15
                                     <---------AGP1                ------>MYB46(1)     <---------ARR14(2)
       <---------HSFB2a(2)           <---------ARR11(3)           --------->MYB55(1)   --------->ARR11(2)
       --------->HSFB2a(2)         ----------->ARR10             --------->AtMYB61     <---------ARR11(2)
   --------->GLK1(1)          --------->DAG2   >>>>>>>>>GATA-4   <---------MYB59       --------->ARR14(2)
  --------->GATA12           ---------->DOF2   >>>>>>>>>GATA-1 --------->ARR11(3)     <------ZmHOX2a(1)
----YAB5     <---------------------WRI1------>ZmHOX2a(2)       <---------ARR11(3)     ==============
agtgagatttctagtacaagatgcgaacaaggtaaagctagatctgtgtggattgaatagaaggaagacctaccgtgagttcaatatgaggaaacgcaga  30115800
                  <------ZmHOX2a(1) --------->ARR14(2)
       ==============================HOX2a_HOX2a                                              ------
       ==================HOX2a_HOX2a--------->GATA12                               <---------DEAR3(1)
       =========================HOX2a_HOX2a                                        <---------ANAC46
       ------>ZmHOX2a(2)            <---------ARR14(2)            --------->ARR11(2)         <------
       ======================HOX2a_HOX2a                          --------->ARR14(2)         <------
     <---------GATA12         <------ZmHOX2a(1)                   <---------ARR11(2)        <-------
 <---------At4g35610  <------ZmHOX2a(1)              ----------->GT1          --------->DOF5.7(1)
 --------->At4g35610 --------->DOF5.7(1)             <----------ID1          --------->DOF5.7(1)<---
==============HOX2a_HOX2a<------ZmHOX2a(1)         ----------->GT1<---------ARR14(2) <------NtERF2
gtgaagctgatcgagcgatgaggaaggaggagaggaccagattggagaattggaaggcgaaaaacatcggaacctcttagaagagggcggagaagaatta  30115900
                  --------->ARR11(2)                                                 <------ZmHOX2a(2)
                  --------->ARR14(2)                                                --------->ARR11(2)
           ------>ZmHOX2a(2)                                                        <---------ARR11(2)
          <------ZmHOX2a(2)          <---------O2                                   <---------GATA12
         <---------AGP1             <---------ARR14(2)                              --------->GATA12
         <---------GATA12     --------->ANAC58            --------->AtMYB61    <---------ARR11(2)  -
         --------->GATA12     --------->ANAC58          >>>>>>>>>MYB2         --------->KAN1       <
--->YAB1 --------->ARR11(3)   --------->ANAC46      --------->REM1(2)      <---------At4g35610   ---
---KAN1  <---------ARR11(3)  <---------LBD16      --------->At5g28300      --------->At4g35610   <--
---YAB5  --------->RVE1(2)--------->KAN1         ----------->GT1           <---------ZAT2  ---------
--AHL12(2)--------->GLK1(1)<---------ARR14(2)    <---------ANAC46          --------->ZAT2  ---------
------YAB5<---------GLK1(1)--------->ARR14(2)----------->HVH21        ----------->HVH21    ---------
tcgtcgaagtaagatctcttggttccgcaatatacggcagacatggccctggccgtgaaaaccaaaacaagaattgacagctgattcgatccaaacgcga  30116000
   <---------TOE2(3)                                         --------->GATA12
   <---------TOE1(3)                                     ------>NtERF2
-------->WOX13(2)                                       --------->DEAR3(1)                 ---------
---------WOX13(2)                                   <---------KAN1                      <---------SPL7(1)
------>AHL20(2)                                     <---------GLK1(1)                  <---------ANAC46
-------AHL12(1)                 --------->At4g35610 <---------HSFB2a(1)          <------ZmHOX2a(1)
>ANAC58                    >>>>>>>>>TBF1           --------->GLK1(2)            --------->DOF5.7(1)
>ANAC46                 >>>>>>>>>TBF1              --------->ARR14(2)        <------ZmHOX2a(1)    <-
>ANAC58           <------ZmHOX2a(1)--------->YAB5 <---------GLK1(2)        <---------TOE2(3)      <-
taaattagggtttagggagaaggagaagaagaagaagatgactcttgaagaaagaatctccgacgatcgagagagattgaggaaggagcgtcgtaagaga  30116100
    --------->RVE1(2)                                                                          <----
   <---------CCA1(2)                                                                          <-----
   <---------ARR14(1)                                                                --------->WOX13(2)
 --------->ANAC55(2)                                       --------->YAB1<-----------RAV1(2) <------
 <---------ANAC58                           <---------GLK1(1)           *TSS     <---------MYB59
 <---------ANAC58                           --------->GLK1(1) ---------->DOF2  --------->ARR11(3)
 <---------ANAC55(2)                      <---------ANAC58 --------->TOE1(3)   <---------ARR11(3)---
 <---------ANAC46            <---------TOE1(3)   <----------DOF2      --------->ANAC58      <-------
>DOF5.7(1)    --------->GLK1(2)      --------->ATHB12 <----------DOF2 --------->ANAC58   <----------
--------ARR14(2)             <---------TOE2(3)   <---------DOF5.7(1)<-----------RAV1(2) <-----------GT1
--------ARR11(2)         <----------DOF2  <---------ANAC58 --------->TOE2(3)<------ZmHOX2a(1)<------
ggtttcgtatctaagaaaatctaatcgggttttaggttttcgattgggtttccttttctttatcttaaaggccaggccaggagaccttattttacccttt  30116200
      <---------RVE1(2)       --------->TOE1(1)                   --------->LBD16
      --------->GATA12       --------->HSFB2a(2)                 <---------ANAC58
      <---------AGP1<------NtERF2                                <---------ANAC58
      --------->AGP1<---------At4g35610                          <---------ANAC46
      --------->ARR14(2)<---------ANAC58                     <-------GAMYB
-------TBP        <-----------RAV1(2)                       <---------ANAC58
----DOF5.7(1) <---------At4g35610  <----------DOF2          <---------ANAC46
----DOF2------>ZmHOX2a(2)<----------DOF2                <-------GAMYB                           <---
------>AHL20(2)  <------NtERF2--------->TOE2(1)         <----------DOF2                        <----
--DOF5.7(1)---------->DOF2   <---------HSFB2a(2)       <------NtERF2                        <-------
-GT1 <---------CCA1(2)  <---------ANAC58  --------->WOX13(1)<---------ANAC58            <---------DOF5.7(1)
---DOF5.7(1)  --------->At4g35610<---------TOE1(2)    ------>NtERF2             ------>NtERF2-------
ttatatacagatctttaagcggcaggggctttctcgtacttttgttaatcacatgggcgcgttgcgttgcgcgtgaaactccctgccaacgtttttttct  30116300
      <---------AHL20(3)                                                        --------->YAB1
      --------->ARR11(3)                                                      <---------AHL12(2)
      --------->AHL12(1)                                                    --------->AHL20(2)
      --------->AHL25(2)                                                    <---------AHL12(1)
      <---------AHL25(3)                                                   <---------AHL20(3)
      --------->AHL20(1)                                                   --------->AHL20(3)
      <---------AHL25(2)                                                   --------->AHL25(3)
     --------->AHL25(1)                 <---------MYB52(1)                 <---------AHL12(3)
     <---------AHL12(1)          <-----------GT1                           <---------AHL20(2)
     --------->AHL25(3)      <---------DOF5.7(1)                           --------->AHL12(3)
     --------->AHL12(1)     <---------DOF5.7(1)                            <---------AHL25(2)
     --------->AHL12(3)     <----------DOF2  ---------->DOF2              --------->AHL12(2)
------DOF5.7(1)       --------->YAB5   <---------DOF5.7(1)              ------->TEIL
------DOF2            <---------ICU4  <---------DOF5.7(1)            <---------ANAC46         ------
----GT1              <---------YAB1  ------>NtERF2                   ----------->GT1--------->KAN1
--->ID1         <---------At4g35610---------->ID1        --------->MYB46(3)<---------AHL25(1) ------
tttttcaaatattttgtttatctgataattccttttttgcccccttagtaaagttatctaacaaacaatatgatgtatattatttataaattctgccatg  30116400
                                             <-------TEIL                                        ---
                                            <---------ANAC46                                    <---
                                          <---------MYB46(3)                                    <---
                                         --------->ALFIN1                                      -----
 --------->YAB5              --------->At4g35610                        --------->LBD16     <-------
--->AtLEC2                   ----------->RAV1(2)                   <---------ARR14(2)  XXXXXXXXXXXXX
----->GT1 --------->RVE1(2)  <---------At4g35610          <---------CCA1(2)<---------KAN1 --------->YAB1
taaatcactagaaaatcgacttgaattcattcatctgaagaacagtggtgcataatactgcataccttcgtattccgaatttcatagtaactagcatgaa  30116500
     <-------MYC3                     <-----------GT1
     ------->MYC3                   --------->WOX13(2)
------>YAB5                         <---------WOX13(2)
-------ICU4                        --------->MYB52(2)                       <---------YAB5
------>KAN1                      <---------MYB52(1)                       <---------ICU4         ---
------ATHB12                     ------>ZmHOX2a(1)                       <---------YAB1       <-----
------YAB5                      --------->TOE1(3)             --------->TOE2(3)           --------->DAG2
-->TEIL                         --------->TOE2(3)       --------->YAB5   --------->ICU4   --------->DOF5.7(1)
--KAN1                       <---------ARR14(2)     <-----------GT1      --------->KAN1  --------->DOF5.7(1)
XXXXXXX>MIR4227              --------->ARR14(2)   <---------KAN1       --------->YAB1   ---------->DOF2
tcattccacatggagccaatagaaaacaaacaaatccttagttacaaaatcgattaaaccgattacattatttgtcataatcgttgaatagaaaaggctt  30116600
       <---------WOX13(2)                       <----------DOF2                                  ---
       --------->AHL12(2)     ----------->RAV1(1)                                                <--
       --------->WOX13(2) <---------ARR11(2)    <---------GLK1(1)                                <--
  ----------->GT1         --------->ARR11(2)   <---------ANAC58                                  <--
 <---------TOE2(3)      <------MYB46(1)        <---------ANAC58--------->ZAT6                    ---
 <---------TOE1(3)      <------MYB83 ----------->GT1      --------->ZAT2                         ---
------>YAB1            <---------AtMYB61<-------TEIL      --------->At4g35610             ----------
-----DOF2              --------->MYB59--------->TOE1(2)   <---------At4g35610  <---------ANAC46-----
ttataaggttaattcatcaaactggtttggttccaccagaacgtacaaaggctttcccttcagcttacactgcccctacatatcgtagacaatgagttat  30116700
<- Previous    Next ->

AGI:  At1g80040.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32440.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN67646.1); contains InterPro domain UBA-like (InterPro:IPR009060)
Range:  from: 30114040    to: 30116173    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At1g80050.1   
Description:  APT2 (ADENINE PHOSPHORIBOSYL TRANSFERASE 2); adenine phosphoribosyltransferase. Identical to Adenine phosphoribosyltransferase 2 (APT2) [Arabidopsis Thaliana] (GB:Q42563;GB:Q39004); similar to APT5 (ADENINE PHOSPHORIBOSYLTRANSFERASE 5), adenine phosphoribosyltransferase [Arabidopsis thaliana] (TAIR:AT5G11160.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO44252.1); contains InterPro domain Purine/pyrimidine phosphoribosyl transferase, conserved site; (InterPro:IPR002375); contains InterPro domain Adenine phosphoribosyl transferase; (InterPro:IPR005764); contains InterPro domain Phosphoribosyltransferase; (InterPro:IPR000836)
Range:  from: 30116407    to: 30118217    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version