AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                     --------->ZAT14
                                                     <---------ZAT14
                                                     <---------ZAT18                  <------MYB46(1)
                                                   --------->ANAC46                   <------MYB83
                                                 --------->ZAT6                   <-----------RAV1(1)
                                              <-----------GT1                    <---------YAB1
                      <---------ARR11(3)   --------->ATHB51                   <---------YAB1
             --------->DAG2                <---------ICU4                     <---------MYB52(1)
            <---------ZAT14                <--------HAHB4                    --------->TOE2(3)
            ---------->DOF2               <---------YAB1  ----------->HVH21<---------YAB5
->HVH21  <---------WOX13(2)               --------->ICU4--------->ANAC46 --------->YAB1     <-------
 
agttctcatcttaagtaaagtgctagagcttctctgaatcggagcattattaccactacacttgacaacttctccatcatcgttattgttggtattactg  29576600
                                                        --------->LBD16
                                                     --------->MYB52(1)
                                                   <---------ARR14(2)
                                              --------->GLK1(2)
                                              <---------ARR11(2)
                                              <---------ARR14(2)
                                             <---------ARR14(2)
                       --------->ANAC55(2)   <---------GATA12
                       <---------ANAC55(2)  --------->HSFC1(2)
                   <-----------HVH21        <----------TaMYB80
                <-------PIF5                --------->HSFB2a(1)                                    <
                ------->PIF5                <---------HSFB2a(1)                                 <---
               --------->O2            <---------LBD16<---------LBD16                     <---------MYB59
               <---------O2 <---------ANAC46--------->KAN1                                --------->TOE2(2)
<---------KAN1<---------LBD16 --------->HSFB2a(2)  <---------ARR11(2)                     --------->TOE2(3)
--At5g28300  <---------ALFIN1 <---------HSFB2a(2)  --------->ARR11(2)                   --------->RVE1(2)
 
cgactgtctcgtcttcccacggggtcacgttttgtagaaactctcggagattccgataccggagttaaacctctagattgaagctcgtccatacctaagt  29576700
                                                                               --------->ANAC58
                                                                               --------->ANAC58
                                                                             ------>NtERF2
                                                                            ----------->HVH21
                                                                           ------>NtERF2
                                                                       --------->ANAC46
                                                                   <---------HSFB2a(1)
                                                                   <---------GLK1(1)
                                                                  <---------RVE1(2)
                                                                  <-----------ARR10
                                                                  <---------ARR14(3)
                                                                  --------->ARR14(3)
                                                                  <---------GATA12
                                                                  --------->GLK1(2)
                                                                  --------->GATA12
                            <---------------AGL15                 <---------ARR11(3)
                       <---------ANAC58                           <---------ARR14(2)
                       <---------ANAC58                  <---------ANAC46  --------->LBD16
                      --------->ZAT2                     <---------ANAC58  <------NtERF2
                      <---------HSFC1(2)                <-------TEIL------>ZmHOX2a(2)
          <-----------ARR10 --------------->AGL15    --------->ZAT2<------ZmHOX2a(2)
          <---------GATA12 <-----------------AGL2    --------->At4g35610  --------->ANAC46
  >>>>>>>>>RAP2.2     <---------ZAT2                 <---------At4g35610  --------->DEAR3(1)
<---------ARR11(3)    --------->HSFB2a(1)          --------->YAB1 <---------ARR11(2)
<---------ARR11(1)    <---------HSFB2a(1)         <---------ATHB12--------->ARR11(3)
<-----------ARR10     --------->HSFC1(2)         ------>MYB83     --------->ARR14(2)
--------->ARR14(2) <---------MYB52(1)           --------->WOX13(1)--------->ARR11(2)
--------->RVE1(2) --------->LBD16         <---------MYB52(2)     <------ZmHOX2a(1)                 =
---------CCA1(2)<---------LBD16         --------->GLK1(2)<---------ANAC58<---------LBD16           <
----TEIL  --------->RVE1(2)<-----------------AGL3------>MYB46(1)----------->ARR10                 <-
 
ccatatctaaacaaatctcaccggaagcttgctgtttatggagaaactgaccaatcagcttcgtgggaggatcttcgccgcgacgaaactcaaaaccctc  29576800
                               --------->WOX13(1)
                            <---------AGP1
                            --------->GATA12
                            <---------ARR11(2)
                            --------->ARR14(2)
                            <-----------ARR10
                            --------->ARR11(2)
                            <---------ARR14(2)
                            <---------ARR11(1)
                            --------->RVE1(2)
                            --------->ARR11(3)
                            <---------GATA12
                            <---------ARR11(3)
                            --------->GLK1(2)
                           <---------ARR14(1)
                           <---------CCA1(2)
                         <---------DEAR3(1)
                         <---------ANAC46
                        <------NtERF2
                        <---------LBD16
                        --------->ATERF1(1)
                        <---------At4g35610
                       <---------RAP2.6(1)
                       <---------ATERF1(1)
                       <---------RAP2.3(1)
                       ------>NtERF2
                       <---------RRTF1(1)
                       <---------ORA47(2)
                       <---------ERF1
                      <---------ANAC58
                      --------->ATERF1(2)
                      <---------RRTF1(3)          ----------->RAV1(1)
                      <---------RRTF1(2)         <------NtERF2
                      <---------ANAC46          <------NtERF2
                      <---------RAP2.3(2)       <---------At4g35610
                      <---------ANAC58          --------->At4g35610
                      <---------RAP2.3(3)       ------>NtERF2
                      <---------DREB2C(2)      --------->DEAR3(1)
                      <---------DEAR3(1)       --------->RAP2.3(2)
                      <---------ATERF1(2)      --------->RRTF1(2)
                     --------->ATERF1(1)      --------->RAP2.3(1)
                     <---------ABI4(1)      --------->DEAR3(1)
                     <------NtERF2          --------->ANAC46
                   --------->ALFIN1         ------->GAMYB
                 --------->O2<---------KAN1--------->DEAR3(2)
                 <---------ANAC46          --------->MYB46(3)
                 ==================================MYC_MYB
                 <---------O2<------ZmHOX2a(2)--------->RRTF1(1)
                 ===================================MYC_MYB
                 <---------TGA1a           <---------MYB55(2)
               <-----------HVH21       <---------KAN1         <----------DOF2  --------->REM1(1)
           <---------ALFIN1<------NtERF2  -------->P  --------->ICU4        --------->TOE1(3)
   <-----------RAV1(1)<---------RAP2.6(2)--------->MYB52(1)  <---------DOF5.7(1)   <-----------HVH21
===========================bZIP_DOF   --------->RVE1(2)<---------ICU4       --------->TOE2(3)
----------DOF2--------->ANAC46------>ZmHOX2a(2)----------->RAV1(1)   <---------TOE1(3)
--------DOF5.7(1)--------->TGA1a  --------->YAB1--------->LBD16      <---------TOE2(3)
 
atctttttgttgctcccccgtcgtggcggcggatctatcagaatcaaccgccgcagcattatgacctttgttgaggttaccttcaccatcagtccaaaaa  29576900
                 <---------ARR11(3)
                 --------->ARR11(3)
                 --------->RVE1(2)
                 <-----------ARR10
                 --------->ARR14(2)
                 <---------ARR11(1)
        <---------CCA1(2)
      <---------ANAC58
      <---------ANAC58                                            --------->DEAR3(1)
  <---------ANAC58                                              <---------At5g28300
  <---------ANAC58                                       <---------ANAC58
 <---------At4g35610                    <---------ATERF1(1)<---------MYB52(1)                     --
 --------->ZAT2 <---------CCA1(2)       --------->KAN1--------->ARR11(2)                          <-
 --------->HSFC1(2)                    --------->ARR14(2)<---------ANAC58                       <---
 <---------HSFC1(2)       --------->ZAT14     --------------------->WRI1                        <---
 --------->At4g35610     ------>ZmHOX2a(1) >>>>>>>>>>>>>>>>>LFY<-----------GT1 --------->YAB5  -----
 --------->HSFB2a(1)<----------DOF2  --------->LBD16  <---------ARR11(2)     <---------TOE2(3)<-----
<---------TOE1(2)<---------ARR14(2)<---------LBD16    <-----------GT1  <---------RVE1(2)     <------
 
tcgtagcttccgtctctccatatctttcctacagtctctccggagactccattgttgtttccgttttcaccgtcgattttgacgataacttctcgccggt  29577000
                                                            --------->YAB5
                                                            --------->ATHB12
                                                           <---------ATHB12
                                                          ------>MYB83
                                                          ------>MYB46(1)
                                                         --------->MYB52(1)
                                                        --------->AtMYB61
         ------->GAMYB                               --------->ANAC46
        --------->MYB46(3)                        --------->SPL7(1)
       --------->At4g35610                        <---------REM1(2)
      --------->MYB52(1)                        <---------ZAT18                                  <--
    <---------KAN1                              --------->ZAT18                                 <---
 --------->LBD16                                <---------SPL7(1)                             <-----
--------->RAP2.6(2)                            <---------ANAC58                              -------
--------->RAP2.3(2)                            <---------ANAC46                              <------
------->At4g35610                              <---------ANAC58                             --------
--------At4g35610                             <---------------AtSPL8              ---------->DOF2---
------WRKY38(1)                    <---------GATA12  --------->ANAC58             --------->DOF5.7(1)
------WRKY12                       --------->GATA12  --------->ANAC58     ----------->GT1   --------
---->WRKY18(1)                    --------->GLK1(1)<---------ALFIN1       --------->ANAC58<---------GATA12
------HVH21                 --------->TOE1(2) --------------->AtSPL3      --------->ANAC58--------->ARR11(3)
---DEAR3(2)           ------------>CBF        --------------->AtSPL8    ---------->DOF2   <---------ARR11(3)
 
cagccgcatcaacggccattactcaaacaatccagcgaaatctaggtttagcgtacacaccaacgattagagaaggaaagcaaaaaaaagaaagatttaa  29577100
  <----------DOF2
  <---------DAG2                                                                                 <--
--------------->AGL15                                                                     <---------ANAC55(2)
---------GT1                                                                              --------->ANAC58
------YAB5                                                                                ----------
------GT1                                                                                 --------->ANAC58
-->AHL25(1)                              <---------DOF5.7(1)        <---------DOF5.7(1)   --------->ANAC55(2)
---AHL20(2)                       --------->ARR14(2)   <---------ZAT2                   <--------P--
->AHL20(2)         --------->ANAC58     <----------DOF2<---------At4g35610      --------->DOF5.7(1)<
------>YAB1        --------->ANAC58     <---------DOF5.7(1)     --------->YAB5---------->DOF2  -----
->AHL25(3)       ---------->DOF2  <---------ARR14(2)   --------->ZAT2<----------DOF2  ----------->GT1
 
tcacacttttgggtaactgtgaaagcaagaagaagagaaaacgcttttatttgatcagagctggtgatgactctttgtgagaaaagagagggtaagtaat  29577200
                   <---------TOE2(3)
                  ---------->DOF2
                 --------->AHL20(2)
               <---------WOX13(2)
             <---------------AGL15
        <---------AHL12(1)
        --------->AHL12(1)
       --------->AHL20(3)
       <---------AHL20(3)
       --------->AHL12(2)
       <---------AHL25(2)
       <---------AHL12(2)
      <---------AHL12(2)
      --------->AHL12(2)
     --------->AHL12(3)
     --------->AHL25(2)
     <---------AHL20(2)
     <---------AHL12(3)
     <---------AHL20(3)                                                                          ---
     <---------AHL25(3)                                                                         <---
     --------->AHL20(2)                                                                        -----
     --------->AHL20(3)                                                                        <----
    <---------AHL25(3)                                                                         <----
    <---------AHL25(1)                                                                         -----
    <---------AHL20(2)                                                                         -----
    --------->AHL25(1)                                                                         <----
    --------->AHL25(2)                                                                         <----
    --------->AHL25(3)                                                                         -----
    <---------AHL25(2)                                                                         <----
    --------->AHL20(1)                                                                         <----
    <---------AHL20(1)          --------->REM1(2)                                              -----
    --------->AHL20(2)       <---------ANAC58     --------->ANAC46                             -----
    <---------AHL12(3)       <---------ANAC46     <---------ALFIN1                            <-----
    --------->AHL12(3)       <---------ANAC58   --------->AtMYB61                  --------->ANAC46
-------TOE2(3) --------->WOX13(2)    ------------>CBF                 <----------DOF2         ------
->GT1--------->AHL25(1) ----------->HVH21<---------ATHB12       <---------ICU4     --------->ANAC58
--------->GT1--------------->AGL15 --------->ANAC58   <---------At4g35610          --------->ANAC58-
------ZmHOX2a(1) <---------AHL20(2)--------->ANAC58   --------->At4g35610    >>>>>>>>>SARD1   ------
---->ICU4 --------->RVE1(2)<---------ANAC46   -------->P  --------->REM1(1)  >>>>>>>>>CBP60g -------
 
aaggaaataaaattatctaattaaagtatgacgcgtgtaagccaatcgctaccacacagctacaacatcatcactttgaaatttggacgacacacagaga  29577300
                                        <-----------GT1
                                      <---------AHL20(2)
                                    <---------AHL12(2)
                                    --------->AHL12(2)
                                    <---------YAB1
                                   <---------AHL25(2)
                                   <---------AHL20(3)
                                   <---------AHL20(2)
                                   <---------AHL20(1)
                                   --------->AHL25(2)
                                   --------->AHL12(2)
                                   --------->AHL20(3)
                                   --------->AHL12(3)
                                  --------->AHL12(1)
                                 <---------YAB1
                                 --------->AHL25(3)
                                --------->AHL12(2)
                                <---------AHL25(2)
                                --------->AHL12(3)
<---------DOF5.7(1)             --------->AHL25(2)
--->ZmHOX2a(2)                  --------->AHL20(3)
---ZmHOX2a(2)                   <---------AHL20(3)
---->GATA12                   --------->AHL20(3)
-----ARR11(2)                 <---------YAB1
-----ARR14(2)                 --------->AHL25(1)
---->ARR11(3)                 --------->AHL25(2)
---->AGP1                     <---------AHL20(3)
-----GLK1(2)                  <---------AHL20(2)
-----ARR11(3)                 --------->AHL12(3)
---->ARR14(3)                 --------->AHL25(3)
-----GATA12                   <---------AHL12(3)
-----RVE1(2)                 --------->AHL25(2)
---->ARR11(2)                <---------AHL25(2)
---->ARR14(2)                <---------AHL20(1)            ---------->DOF2
----GLK1(1)                  <---------AHL20(3)   ------>MYB46(1)        --------->DOF5.7(1)
--->GLK1(1)                  --------->AHL12(3)   ------>MYB83    --------->HSFB2a(2)     --------->ANAC46
----->ZmHOX2a(1)             --------->AHL20(3) <---------MYB59   <---------HSFB2a(2)    <---------At5g28300
--->KAN1                     --------->AHL12(2) <---------MYB46(2)<---------HSFC1(1)     <---------LBD16
---->ARR10                 <---------YAB1     --------->RVE1(2)   --------->HSFC1(1)    --------->MYB52(1)
 
tcctcttctccctctctctctctgtgtcttaatattattattttttcaataccaaactttggcaaagttcgagaagaagatgggaacttactcacggcga  29577400
                                                                                --------->ANAC55(2)
                                                                      --------->GLK1(1)
                                                                      <---------GLK1(1)
            <---------YAB1                                            <---------KAN1
           --------->AHL12(2)                                        --------->ARR11(3)            -
         <---------YAB1                                             <------ZmHOX2a(1)              -
   --------->MYB59 --------->TOE2(3)                              <---------TOE2(3)                -
   <---------TOE2(3)                            <---------ANAC46  <---------TOE1(3)    <---------YAB1
   <---------TOE1(3)                   <---------KAN1         <----------DOF2 <-----------GT1<------
 
accatttaggtttttattatttcgtcaaactttggcaaactaatatttgtttagtatacattttgttttaaggatatcgttttacatattttgtttgatt  29577500
<- Previous    Next ->

AGI:  At1g78610.1   
Description:  mechanosensitive ion channel domain-containing protein / MS ion channel domain-containing protein. Identical to Uncharacterized mscS family protein At1g78610 [Arabidopsis Thaliana] (GB:Q9SYM1); similar to mechanosensitive ion channel domain-containing protein / MS ion channel domain-containing protein [Arabidopsis thaliana] (TAIR:AT2G17000.1); similar to mechanosensitive ion channel domain-containing protein / MS ion channel domain-containing protein [Arabidopsis thaliana] (TAIR:AT1G53470.1); similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G14810.1); similar to hypothetical protein OsI_008239 [Oryza sativa (indica cultivar-group)]
Range:  from: 29573923    to: 29577019    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version