AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
             --------->ATERF1(1)
            <---------DREB2C(1)
            --------->DREB2C(1)
            <------NtERF2
           <---------DEAR3(1)
           --------->RAP2.3(2)
         ------>NtERF2
      <---------LBD16
    --------->ARR14(2)
    <---------ARR14(2)
   <---------GLK1(1)
-------At4g35610
------>ZAT2--------->RAP2.6(2)
-------ZAT2<---------ATERF1(1)
------>ATERF1(1)
-----GAMYB--------->ATERF1(1)
------>At4g35610
----NtERF2--------->RAP2.3(1)
-->NtERF2<---------ATERF1(1)
------MYB46(3)
------RAP2.3(1)
------DEAR3(2)
------ERF1--------->DEAR3(2)
------ATERF1(1)
----->MYB55(2)
-----ANAC46--------->DEAR3(1)                       <---------TOE2(2)
---->ATERF1(2)                                      --------->SPL7(1)
-----RAP2.3(3)                                      <---------TOE1(2)
-----DEAR3(1)<------NtERF2                        --------->TOE1(2)
-----ATERF1(2)  <---------ANAC46                  <---------SPL7(1)
-----RAP2.6(2) ------>NtERF2                     ------>ZmHOX2a(2)
-----RAP2.3(2)--------->DEAR3(1)                 =====================================HOX2a_HOX2a
--->RAP2.3(1)--------->RAP2.3(1)                 ==================HOX2a_HOX2a       <---------RVE1(2)
--->ATERF1(1)--------->DEAR4(2)                  ===============================HOX2a_HOX2a
--->DEAR4(2)<---------At4g35610            --------->YAB5                         --------->ALFIN1
-NtERF2 <---------ATERF1(1)                --------->YAB1                       <---------ANAC46
---DEAR4(2)<---------ATERF1(2)            --------->ICU4                 <------ZmHOX2a(1)
---ATERF1(1)<---------ATERF1(1)           <---------YAB1  <---------TOE2(3)     --------->ALFIN1
---RAP2.3(1)------>NtERF2      --------->ANAC58  ============================HOX2a_HOX2a       -----
--DEAR3(1)--------->SPL7(1)    --------->ANAC58 --------------->AtSPL3<------ZmHOX2a(1)        <----
--RAP2.3(2)--------->ATERF1(2)<---------LBD16<---------YAB1 <------ZmHOX2a(1)  <------ZmHOX2a(1)
 
ggctggagacccggccgccgcttggagcattagctcggaagtttgatgatgatcgtacgttgaggaaaacagaggaggatgaggagtggagattgctctg  23895400
                                                                   <---------ANAC58
                                                                   <---------ANAC46
                                                                   <---------ANAC58
                                                                   <---------DEAR3(1)
                                                                 <---------MYB46(3)
                                                                 ------>NtERF2
                                                                <---------DEAR3(1)
                                                                <---------AtMYB61
                                                                ----------->HVH21
                                                               --------->ATERF1(1)
                                                               <-------GAMYB
                                                               <------NtERF2
                                                               <---------ABI4(1)
                                                              <---------DEAR4(2)
                                                              <---------MYB46(3)
                                                              <---------DEAR3(2)
                                                              <---------ATERF1(1)
                                                             <---------ANAC46
                                                             <---------DREB2C(2)
                                                             <---------AtMYB61
                                                             <---------DEAR3(1)
                                                             --------->ALFIN1
                                                            <---------ABI4(1)
                                                            ------>NtERF2
                                                            <------NtERF2
                                                            --------->ATERF1(1)
                                                           <---------RRTF1(1)
                                                           ------>NtERF2
                                                           <---------RAP2.3(1)
                                                          <---------RRTF1(2)
                      <---------ARR11(3)                  <---------RAP2.3(2)
                      --------->ARR11(3)                  <---------DEAR3(1)
                     --------->GLK1(1)                   <---------LBD16
                    <---------ARR11(3)                   --------->At4g35610
                   --------->YAB1                     <---------At4g35610    <---------YAB1        <
              --------->HSFB2a(2)                     --------->ZAT2 <------NtERF2                 <
        --------->ARR11(2)        <------NtERF2       --------->At4g35610<---------ARR14(2)        <
        <---------ARR11(2)      <---------ANAC46      <---------ZAT2--------->LBD16               <-
        <---------ARR14(2)     <------NtERF2    <---------ARR14(2)<---------LBD16             <-----
        --------->ARR14(2)     <---------LBD16  --------->ARR14(2)--------->ATERF1(1)      <--------
     --------->ALFIN1<---------GLK1(1)--------->CCA1(2) --------->ALFIN1<------ZmHOX2a(1)--------->YAB1
---->ZAT14    <---------HSFB2a(2)--------->LBD16<---------ARR11(2)<------NtERF2        <---------WOX13(1)
-----ZAT14<---------KAN1     <---------DEAR3(1)<------ZmHOX2a(1)--------->ALFIN1 <---------ZAT6 ----
 
ttctgaaggtggaacttctcgatgatatctcgttggcggagatagacggaggacccgagctgcggcggtggcggaggattgtgagtgttgaatgatgttg  23895500
        --------->ANAC46
       <---------LBD16
  <---------ARR11(2)
  <---------ARR14(2)
  <---------GATA12
  <---------GLK1(2)                                                     ------>ZmHOX2a(2)
  --------->ARR11(2)                                                   --------->At4g35610
  --------->ARR14(2)                                                  --------->ARR11(3)
 <------NtERF2                                            ----------->RAV1(2)
---------ANAC58                                          ======================HOX2a_HOX2a
---------ANAC58                                          ------>ZmHOX2a(1)
---------ANAC46                                     <------MYB46(1)   --------->GATA12
--------LBD16                                       <------MYB83      <---------GATA12
------RAV1(1)                                      --------->MYB59    <---------ARR11(3)    <-------
---RAV1(1)    --------->ALFIN1               <---------KAN1 ------>ZmHOX2a(1)     --------->KAN1
----->ALFIN1 <------ZmHOX2a(1)             <---------ANAC46 ===================HOX2a_HOX2a  --------
 
tggcggattctacggaggagggagtgagaagtgagaagattgagtcgagtgtgtttggtcctcctgctaatatgatctgagacagagatgctctgatttc  23895600
                                     <----------DOF2
                                    <---------ANAC58
                                    <---------ANAC58
                               --------->ATHB12
                              <---------YAB1
                             --------->ARR11(3)
                             <---------ARR11(3)
                            --------->RVE1(1)
                            --------->CCA1(1)
                           --------->AHL25(2)
                           <---------AHL12(1)                                  ----------->GT1
                           --------->AHL12(1)                             <---------KAN1
       <------ZmHOX2a(1)  <---------AHL20(3)                            <---------ANAC46
<---------RVE1(2)         --------->AHL12(2)                        <---------LBD16
--------->ARR11(3)        <---------AHL12(2)                   <---------HSFC1(2)
<---------ARR11(3)        --------->AHL20(3)            -------->P <---------ANAC58         --------
--GLK1(1)            <---------HSFB2a(2)          <-----------GT1  <---------ANAC46         --------
->GLK1(1)            --------->HSFB2a(2)       <---------DOF5.7(1) <---------ANAC58 ---------->DOF2
 
tgagattttaggactgaaattgttctgaaaaatatcattgctttcttccattttttctcaaccagacgtttcgtggagtataagataaaaagaaacccta  23895700
                     --------->YAB1                                    <---------YAB1
                    --------->ICU4                                  --------->ICU4
        --------->ATHB12                                           <---------RVE1(2)          ------
   <---------YAB1   <---------KAN1                                 --------->ARR11(3)        -------
->TOE1(3)           <---------YAB5       --------->DOF5.7(1)     <---------TOE2(3)     ---------->DOF2
->TOE2(3)<---------RVE1(2)             ---------->DOF2     <---------YAB1  <---------RVE1(2)--------
 
acaattgtgtttgatttgatagaatgatggtttttcaagttcaaaagagattgaacaagagtaagattgagataatgagagattgtttttgaaagaaaag  23895800
                            <---------AHL20(2)
                           --------->AHL20(2)
                       ------>ZmHOX2a(2)                <---------------AtSPL8
                      <------ZmHOX2a(2)                 --------------->AtSPL8
                     --------->AGP1                    <---------ANAC58
                     <---------AGP1                  <---------ARR11(3)
                     --------->RVE1(2)             --------->DOF5.7(1)
    <------MYB83     <---------ARR11(3)          ---------->DOF2   <---------AHL20(2)
    <------MYB46(1)  --------->GATA12    <---------TOE1(3)       --------->AHL20(3)
----->GT1            <---------GATA12<-----------TBP --------->ARR11(3)                  --------->ANAC58
-->DAG2              --------->ARR11(3)  <---------TOE2(3)       <-----------TBP         --------->ANAC58
-->DOF2          ---------->DOF2   *TSS ---------->DOF2<---------ANAC58           --------->ARR11(2)
 
tagaatttggtttttttgtttaaagatctatttaatgggtttttaaagtttagaaagagcttgtacatatttatagacttagacagatagacaaggaaaa  23895900
                                                                                                 <--
                                                                         <---------TOE1(3)       <--
                                              <---------ANAC58           <---------TOE2(3)       ---
                                              <---------ANAC58         <---------AHL20(2)      <----
                                          <---------DOF5.7(1)        --------->WOX13(2)        -----
             <-----------TBP             <---------DAG2              <---------WOX13(2)       <-----
      --------->DOF5.7(1)          <----------DOF2                <---------AHL20(2)          ------
      --------->DAG2 <---------GLK1(1)   <---------DOF5.7(1)    <----------DOF2    --------->MYB52(1)
    ---------->DOF2 <---------GATA12     <----------DOF2   <<<<<<<<<TBF1---------->DOF2     --------
 
caaaccagaaaggttgttttatagatttcacatggacgctttgactttttcttgttgatttcttcttcttttatttaaagtttgccaaacgattttcatc  23896000
                                                       ------->GAMYB                     --------->ICU4
                                                       --------->YAB1       --------->YAB1
                                                      --------->MYB46(3)    <---------ICU4
                                                      <---------MYB55(2)    --------->ATHB12
-------YAB5                                          ------>MYB46(1)        <--------HAHB4--------->YAB1
-------YAB1                                          -------->P            <---------ATHB12   ------
------>ICU4                                          ------>MYB83          <---------YAB5<---------YAB1
-----ICU4                                       <-----------GT1          <-----------GT1 <---------YAB5
---->YAB1                                  <---------MYB59               --------->YAB1 --------->WOX13(2)
----YAB5                                <-----------GT1--------->TOE2(3) --------->WOX13(1)   ------
--->ICU4                               <---------ARR11(2)              <---------YAB1   <---------WOX13(2)
->YAB1                    <---------RVE1(2)--------->TOE2(3)      <---------ZAT6   --------->AtLEC2
 
atgattttgctacaaggtttctactctgagataatacaagtagataccttatttccaaccacaattctagtgttattaatcatttcatgctaattataag  23896100
                                                                                          --------->AHL20(2)
                                                                                          <---------AHL25(3)
                                                                                          <---------AHL20(2)
                                                                                          <---------AHL25(1)
                                                                                         --------->AHL20(3)
                                                                                         --------->AHL12(3)
                                                                                         --------->AHL20(2)
                                                                                         <---------AHL20(3)
                                                                                         --------->AHL25(1)
                                                                                         --------->AHL25(3)
                                                                                         --------->AHL25(2)
                                                                                         <---------AHL12(3)
               --------->RVE1(2)                                                        <---------WOX13(2)
              <---------CCA1(2)                                                         --------->AHL12(2)
            --------->ANAC55(2)                                                         <---------AHL12(2)
       <---------YAB1                                                              <---------YAB1
       <---------YAB5<---------ARR11(3)                                          <---------ICU4
     --------->YAB1  --------->RVE1(2)                                           --------->YAB1
     <---------ICU4 <---------CCA1(2)                                            --------->YAB5
<---------ZAT14<---------ARR11(3)            <----------DOF2                    <---------YAB5
--------->ZAT14--------->ARR11(3)         <-----------GT1                       <---------ATHB12
--->ANAC58  <---------ANAC55(2)          <---------ARR11(3)       --------->KAN1--------->ICU4
--->ANAC58 <-------TEIL                  <---------AHL20(1)   <---------AtLEC2--------->YAB1
 
cactatactcatgatacatatctatatctatgagattgtatcaatatacttttctcttgcattttgcataaattcttctactaatcatgaaaattaatag  23896200
                                                                          -------->ATHB1
                                                                          -------->HAHB4
                                                                          <---------AHL25(3)
                                                                          <--------HAHB4
                                                                          --------->YAB5
                                                                          --------->ATHB51
                                                                          --------->YAB1
                                                                         --------->ICU4
                                                                         --------->AHL25(3)
                                                                         <---------YAB5
                                                                         <---------ATHB51
                                                                         <---------ATHB12
                                                                         <---------YAB1
                                                                        --------->WOX13(2)
                                                                  <---------CCA1(2)
                                                                <---------AHL20(2)
                                                                <---------AHL12(3)
                                                                <---------AHL25(1)
                                                                --------->AHL20(2)
                                                                --------->AHL12(3)
                                                                --------->AHL20(3)
               <---------DAG2                                   --------->AHL25(1)
               <----------DOF2                                  <---------AHL20(3)    --------->AHL20(2)
       --------->AHL20(3)                                     <---------AHL20(3)      <---------AHL12(3)
       <---------AHL20(2)                                     <---------AHL12(3)      <---------AHL25(1)
       <---------AHL20(3)                                   <---------CCA1(1)         <---------YAB1
       --------->AHL25(1)                                  --------->ARR11(3)         <---------AHL20(2)
       --------->AHL25(2)                               <---------WOX13(1)<---------ICU4
       --------->AHL20(2)                            <---------YAB1--------->RVE1(2) --------->AHL12(2)
       <---------AHL25(2)                      ------->GAMYB<---------RVE1(1)       <---------KAN1
       <---------AHL25(1)                   --------->MYB52(1)--------->AHL20(3)<---------MYB59
       --------->AHL25(3)                <---------WOX13(2)<---------ARR11(3)<-----------GT1
   --------->YAB1          <---------KAN1--------->WOX13(2)<---------RVE1(2)<---------YAB1       ---
  <---------YAB1   <---------YAB1    --------->TOE2(3)--------->YAB1    <---------WOX13(2) ---------
 
agtctatgattttatttgctttattttagaatgtttttttcattagttaacagactatgatagatatttatatctaattattaccgaatataaatgattt  23896300
<- Previous    Next ->

AGI:  At1g64380.1   
Description:  AP2 domain-containing transcription factor, putative. Identical to Ethylene-responsive transcription factor ERF061 (ERF061) [Arabidopsis Thaliana] (GB:Q9C7W2); similar to RAP2.4 (related to AP2 4), DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT1G78080.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO65814.1); contains InterPro domain DNA-binding, integrase-type; (InterPro:IPR016177); contains InterPro domain Pathogenesis-related transcriptional factor and ERF, DNA-binding; (InterPro:IPR001471)
Range:  from: 23894309    to: 23895836    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version