AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                       --------->WOX13(2)
                     --------->AHL25(2)
                     <---------AHL25(3)
                     --------->AHL25(3)
                     --------->AHL12(1)
                     <---------AHL25(2)
                     --------->AHL25(1)
                     <---------AHL25(1)
                     --------->AHL20(2)
                     <---------AHL12(1)
                     <---------AHL20(2)
                     <---------AHL12(3)                       --------->AHL20(2)
                     --------->AHL12(3)                       --------->AHL25(1)
                    <---------AHL25(1)                        <---------AHL12(3)
                    --------->AHL20(2)                        <---------AHL25(1)
                    <---------AHL20(2)                        --------->AHL12(3)
                    <---------AHL20(1)                        <---------AHL25(3)
                    --------->AHL20(3)                       <---------AHL20(2)
                    --------->AHL25(1)                     <---------WOX13(2)
                    --------->AHL25(3)                     --------->WOX13(2)
                    <---------AHL25(2)                 --------->ANAC46
                    --------->AHL25(2)              <---------At5g28300
                  <---------WOX13(2)               <-----------GT1
               <---------YAB1                   --------->WOX13(2)
              <-----------GT1                 --------->AHL12(1)
            <---------YAB1                    <---------AHL12(1)
           <---------AHL20(3)                 <---------AHL12(3)
           --------->AHL25(2)                 --------->AHL25(1)
           <---------AHL25(2)                 <---------AHL20(2)
         <---------TOE2(3)                    --------->AHL12(3)
         <---------YAB1<---------WOX13(2)     <---------AHL25(3)
        --------->AHL12(2)                    <---------AHL25(2)       --------->RVE1(2)
        <---------AHL20(3)                    --------->AHL25(3)  <---------AHL25(1)
        --------->AHL25(1)                    <---------AHL25(1)  --------->AHL20(3)
        --------->AHL20(3)                    --------->AHL20(2)  <---------AHL20(3)
        --------->AHL12(3)                   --------->AHL25(3)   --------->AHL12(3)           <----
        <---------AHL12(3)                   --------->AHL20(2)  --------->YAB1       --------->TOE2(2)
------->DOF5.7(1) --------->WOX13(2)        --------->AHL12(2)<---------AHL20(2)      --------->TOE1(2)
------>DOF2--------->AHL20(3) <---------RVE1(2) <---------WOX13(2)<---------AHL20(2) --------->YAB1
 
aaagagtcgattaatattatcaatttaattttagataagaagactatatttaatttacccctaatttatattaatctccaatttccaaacatatgagaat  22896400
                                                          --------->AHL20(2)
                                                          <---------AHL20(2)
                                                         <---------AHL20(2)
                                                         --------->AHL20(2)
                                                       <---------AHL12(2)
                                                      <---------AHL25(3)
                                                      <---------AHL12(3)
                                                      <---------AHL25(2)
                                                      --------->AHL20(1)
                                     <---------YAB1   --------->AHL20(2)
                                 <---------AHL20(2)   <---------AHL20(2)
                                 <---------AHL20(3)   <---------AHL25(1)
                                 <---------AHL12(3)   --------->AHL25(1)
                              --------->AHL12(2)      --------->AHL25(2)
                            --------->AHL20(2)        --------->AHL12(1)
                            --------->AHL25(1)        <---------AHL12(1)
                            <---------AHL20(2)       <---------AHL25(2)
                            <---------AHL12(3)       --------->AHL25(3)
                            --------->AHL12(3)       <---------AHL25(3)
                            <---------AHL25(1)       --------->AHL25(2)
                            <---------AHL25(2)       <---------AHL25(1)
                            --------->AHL12(1)       --------->AHL20(2)
                            <---------AHL12(1)       --------->AHL12(3)
                            <---------AHL25(3)       <---------AHL12(3)
                            --------->AHL25(3)       --------->AHL25(1)
                           --------->AHL20(2)        <---------AHL20(2)
                           --------->AHL25(3)        --------->AHL12(1)
                          --------->AHL12(2)         <---------AHL12(1)
                        <---------AHL20(2)          --------->AHL12(3)
                        --------->AHL12(3)          <---------AHL25(2)
       --------->TOE2(3)--------->AHL25(1)          <---------AHL20(1)
       --------->YAB1   <---------AHL12(3)          --------->AHL25(3)
   <---------AHL20(2)  --------->ARR11(3)           <---------AHL20(3)
   --------->AHL20(2)  <---------ARR11(3)           --------->AHL25(2)
   --------->AHL25(1)  --------->AHL20(1)           --------->AHL20(3)             --------->YAB1
   <---------AHL25(1)  <---------AHL25(2)           --------->AHL12(2)           <---------KAN4(2)
   <---------AHL12(1)  <---------AHL20(1)          --------->YAB1             <---------ANAC46
   --------->AHL12(1)  --------->AHL25(3)    ----------->GT1                  ----------->GT1
   <---------AHL25(3)  --------->AHL25(2)    <---------ZAT6              <---------ANAC58
  <---------ATHB12    --------->CCA1(2)    <---------ANAC58              <---------ANAC46
 --------->WOX13(2)  <---------ARR11(3)    <---------ANAC58              <---------ANAC58
 <---------WOX13(2)  --------->ARR11(3)    <---------ANAC46              --------->ANAC55(2)     <--
-----KAN1        ---------->DOF2<---------ICU4   --------->AHL20(2)      <---------ANAC55(2)    <---
 
ttccaattaatcttattttgtaaagatatatttaatttttatgaattcgtgttaaaataatttaaaaacgatacttacgtagagtataatcaagttggaa  22896500
                               --------->KAN1
                              --------->AHL20(2)
                              <---------AHL25(3)
                              <---------AHL20(2)
                              --------->AHL20(3)
                              <---------AHL25(2)
                              --------->AHL25(2)
                              <---------AHL25(1)
                              <---------AHL20(3)
                            --------->AHL12(2)
                            <---------AHL12(2)
                           <---------AHL20(2)
                           --------->AHL25(2)
                           <---------AHL20(3)
                           --------->AHL20(3)
                           <---------AHL25(2)
                          --------->AHL12(1)
                         <---------YAB1
              <---------ARR11(3)
             <------ZmHOX2a(1)--------->AHL25(1)
   ------>ZmHOX2a(1)     <---------YAB5
  --------->TOE2(3)      --------->ICU4                            <------ZmHOX2a(2)
 <---------ICU4       <---------YAB1 <---------------AGL15        --------->ARR11(3)
 --------->YAB5      <------------------------ANAC81 --------->GATA12
-------AHL25(3)<---------RVE1(1) <-----------GT1     <---------GATA12                             --
------KAN1--------->YAB1 --------->AHL12(2)    <-----------GT1    <---------ARR11(3)              --
 
taaatccttactatcaggattttttgttattattttattccattttttagttactggatgtgactataagatcatccaagaatacaaatgtttttttggg  22896600
                                                                                                  --
                                                                                             <------
                                                                                        <---------AHL20(2)
                                                                                        <---------AHL25(1)
                                                                                        <---------AHL25(2)
                                                                                        --------->AHL25(3)
                                                                                        --------->AHL25(2)
                                                                                        <---------AHL25(3)
                                                                                        --------->AHL20(1)
                                                                                        --------->AHL12(3)
                                                                                        --------->AHL20(2)
                                                                                        <---------AHL20(1)
                                                                                        --------->AHL25(1)
                                                                                        <---------AHL12(3)
                                                                                       --------->AHL20(3)
                                                                                       <---------AHL12(3)
                                                                                       --------->AHL12(3)
                                                                                       <---------AHL20(3)
                                                                                       <---------AHL25(2)
                                                                                       --------->AHL25(3)
                                                                                       <---------AHL25(1)
                                                                                       --------->AHL20(2)
                                                                                       <---------AHL20(2)
                                                                                      <---------AHL12(2)
                                                                                      --------->AHL12(2)
                                                                                     <---------AHL25(2)
                                                                                     <---------AHL12(3)
                                                                                     --------->AHL25(2)
                                                                                     <---------AHL20(3)
                                                                                     --------->AHL20(3)
                                                                                     <---------AHL12(2)
                                                                                    <---------AHL25(2)
                                                                                    <---------AHL25(1)
                                                                                    --------->AHL25(1)
                                         --------->ARR14(2)                         <---------AHL12(3)
                                         --------->ARR11(2)                         --------->AHL25(2)
                               <---------AHL20(2)                                   <---------AHL25(3)
                               <---------AHL25(3)                                   <---------AHL12(1)
                              <---------YAB1 <----------DOF2                        --------->AHL12(1)
--------->DOF5.7(1)          --------->AHL12(2)           ----------->GT1           --------->AHL12(2)
<----------ID1              --------->YAB1   ------>ZmHOX2a(1)                     <---------AHL12(1)
-------->DOF2       --------->ZAT6       <---------ARR11(2)                        --------->AHL25(3)
------->DOF5.7(1) <-----------GT1        <---------ARR14(2) <---------RVE1(2)      --------->AHL12(1)
 
aaaaagacaaaatttgggttctaactctccataataaatgtaagtatccttttgtaagaaatggataatataggtgtcaaatttgaataattttattttc  22896700
                                                                                     --------->AHL20(2)
                                                                                  --------->YAB5
                                                                                 <---------AHL20(2)
                                                                                <---------WOX13(1)
                                                                              --------->ATHB12
                                                                              <---------ICU4
                                                                              -------->HAHB4
                                                                              --------->ATHB51
                                                                              <--------ATHB1
                                                                             <---------ATHB51
                                                                             <---------YAB1
                                                                             <---------ATHB12
                                                                       --------->RVE1(2)
                                                                     --------->RVE1(2)
                               --------->KAN1                        --------->ARR11(3)
                           ----------->TBP                       *TSS--------->GLK1(2)
                    --------->KAN1                           ---------->DOF2 --------->ICU4
                    <---------At4g35610                   --------->TOE2(3)  <---------YAB5       --
------->ATHB12 <---------ZAT14 <-----------GT1            --------->TOE1(3)--------->YAB1        <--
-----GT1       <---------REM1(2)     ------>ZmHOX2a(1)  ------->TEIL <---------ARR11(3)       <-----
 
ttcatttgtactcttgtcttcacagatgctatatatactcctccatttctctcggtgtgaaccttatagcaaaatctctaataattgattatatgaatta  22896800
                                         <---------AHL12(2)
                                         --------->WOX13(2)
                                         <---------WOX13(2)
                                        <---------AHL20(2)
                                        <---------AHL12(3)
                                        <---------AHL20(3)
                                        <---------AHL25(3)
                                        --------->AHL20(3)
                                        --------->AHL25(1)
                                       --------->AHL25(1)
                                       <---------AHL20(2)
                 <---------AHL20(2)    <---------AHL25(1)
                 --------->AHL20(2)    --------->AHL25(3)
                 <---------AHL25(1)    --------->AHL20(2)
                 --------->AHL25(1)    --------->AHL12(1)
           --------->YAB1              <---------AHL12(1)
       <---------AHL20(2)      <---------YAB5
      --------->AHL20(2)     --------->WOX13(1)
      <---------AHL12(3)    --------->AHL25(1)                                        --------->DOF5.7(1)
      --------->AHL12(3)    <---------AHL25(1)                                        --------->DAG2
      --------->AHL20(3)    <---------AHL25(3)                                       --------->DOF5.7(1)
      --------->AHL25(2)    <---------AHL12(1)                                      ---------->DOF2
      --------->AHL25(1)    --------->AHL12(1)                               <---------ANAC58      <
      <---------AHL20(3)    <---------AHL20(2)                          <---------REM1(1)         --
   --------->AHL12(2)       --------->AHL20(2)               ----------->GT1 <---------AtLEC2     <-
   <---------AHL12(2)     --------->WOX13(2)         <---------TOE2(3)  <-----------RAV1(1)      ---
--------->GT1  --------->WOX13(2)     <---------WOX13(1) --------->DOF5.7(1) <---------ANAC58   ----
-------YAB5----------->GT1<---------WOX13(2)   <---------RVE1(2)        <---------MYB46(3)    ------
----AHL20(2)   <---------WOX13(2)   --------->YAB5  ---------->DOF2  <---------MYB46(3)     --------
 
atggttaaattttatagtaattaaacttgaattaatcagtgattaatttagagattaaagaagagggtgaagttgttgttgcatggcaaaaggtcgaaag  22896900
                                                                   <---------ARR11(2)
                                                                   --------->ARR11(2)
                                                                  --------->DOF5.7(2)
                                                            <---------HSFB2a(1)
                                                            --------->HSFC1(2)
                                                            --------->HSFB2a(1)
                                                            <---------HSFC1(2)
                                                          --------->ARR14(2)
                                                          <---------ARR11(2)
                                                          <---------GLK1(2)
                                                          <---------ARR14(2)
                                                          --------->ARR11(2)
                                                       --------->ANAC46
                                                       --------->ANAC55(1)
          <---------LBD16                     ----------->HVH21   <---------MYB52(1)
 ------>NtERF2                            <---------At5g28300    <-----------HVH21
<---------ETT(2)                         --------->MYB52(1)--------->KAN1
------NtERF2                         --------->REM1(1) --------->ANAC55(2)
---->NtERF2 --------->LBD16      <---------At4g35610   <---------ANAC55(2)           <---------DEAR3(1)
--------ATERF1(1)                --------->At4g35610   --------->ANAC58           <---------ZAT2
------>DEAR3(1)                 --------->ANAC58       --------->ANAC58      <---------KAN1
----->DEAR3(2)                  --------->ANAC58   <-----------HVH21<---------DOF5.7(2)            <
--->DOF5.7(1)      <------ZmHOX2a(2) <---------ALFIN1 <---------LBD16--------->DEAR3(2)     <------ZmHOX2a(1)
-->DOF2  ------->TEIL     --------->TOE1(2)  --------->At5g28300 <-------GAMYB    --------->ZAT2  <-
 
ccgacgacaatgaaccggagcgatcgataccttggaagctacacttacggtgacagtcacggaaactccgttaccgacgaattagagctcggtgaggaag  22897000
                                                                                               -----
                                                                                              <-----
                                                          --------->ALFIN1                    ------
                                                         ------->PIF5                         ------
                                                         ------->MYC2                         <-----
                                                         <-------PIF5                         <-----
                                                         ------->MYC4                         ------
                                                         <-------MYC2                        <------NtERF2
                                                         ------->MYC3                        <------
                                                         <-------PIF4                        =======
                --------->WOX13(1)                       ------->PIF4                        -------
              <------NtERF2                              <-------MYC3                        =======
             <---------RAP2.6(3)                         <-------MYC4                        <------
             <-----------HVH21--------->DEAR3(1)        <---------TGA1a                      <------
            --------->RAP2.6(2)                         <---------ANAC46                     =======
           --------->SPL7(1)  --------->AtMYB61         --------->O2                         <------
        --------->MYB46(3)    <---------ALFIN1          <---------O2                         -------
        --------->DEAR3(1)   --------->MYB46(3)    --------->ANAC58                          =======
       --------->ATERF1(1)   <---------ABI4(2)     --------->ANAC46                          =======
       --------->At4g35610  ------>NtERF2          --------->ANAC58                         ------>NtERF2
       <---------At4g35610 --------->ANAC46       --------->SPL7(1)                        <--------
       --------->DEAR3(2)------>NtERF2           ------>ZmHOX2a(1)   --------->ANAC58      <--------
     <---------WRKY12   --------->bZIP60(1)     --------->TOE1(2)    --------->ANAC58      <--------
     <---------WRKY38(1)<---------bZIP60(1)     --------->TOE2(2)    --------->ANAC46 --------->DOF5.7(1)
   <-----------HVH21    --------->ANAC46    --------->GLK1(1)      <---------ANAC58  --------->DOF5.7(1)
---------At4g35610   --------->ANAC46      <------ZmHOX2a(1)       <---------ANAC58  --------->MYB52(1)
--------GATA12<---------MYB52(1)       <---------KAN1   --------->TGA1a             --------->DOF5.7(1)
 
acatctggtcaccggccgtcattcacgacgacaccaccgagaatgaggaatcctacggcacgtggaacttacgcgctaccttgggaaaaaacgggcgcgt  22897100
                                          --------->ATERF1(1)
    <-----------RAV1(1)                   <------NtERF2
  <---------ARR14(2)                    --------->RAP2.3(3)
  --------->ARR14(2)                    --------->RAP2.3(2)
 <------ZmHOX2a(1)                      --------->RRTF1(3)
---->ALFIN1                             --------->DEAR3(1)
--PIF5                                 --------->ATERF1(1)
->MYC3                                ------>NtERF2
->PIF5                                --------->LBD16
--MYC3                                <---------ATERF1(1)                         <------ZmHOX2a(1)
--MYC2                    <----------DOF2<---------ATERF1(1)                    --------->ALFIN1
->MYC2                    --------------------->WRI1                        <---------LBD16
---ANAC58                <---------DOF5.7(1)                              --------->ANAC46
=========================bZIP_DOF   <---------LBD16                      <---------At5g28300
-->TGA1a              --------->ZAT18--------->DEAR3(1)                  <---------LBD16
========================================MYC_MYB                      <---------ARR14(2)
---TGA1a              <---------ZAT18<---------ALFIN1                --------->ARR14(2)
---ANAC46     <----------DOF2  <--------P------>NtERF2               <---------GATA12
===================================bZIP_DOF                      <---------At4g35610
---ANAC58    <---------ANAC58 <-------GAMYB                   <---------ZAT14  --------->ATERF1(1)
-->ALFIN1    <---------ANAC58 <---------ANAC58                <---------ZAT18  <------NtERF2
=====================================bZIP_DOF                 --------->ZAT14<---------DEAR3(1)
======================================MYC_MYB           --------->YAB1 <-------TEIL--------->ALFIN1
-ANAC46    ------>NtERF2<----------DOF2--------->RAP2.3(1)    --------->ZAT18<---------ANAC46
-ANAC58  --------->ATERF1(1)  <---------ANAC58         <---------YAB1--------->GATA12 --------->ALFIN1
-ANAC58 <---------At4g35610  <---------MYB46(3)     --------->DEAR3(1)--------->CCA1(2)         <---
 
gggaggattgtcgctggctttcgagggctctttggttgctccgccgtcgtcttcgccgatgatagtgcagaagattcacggcggaggaggtgagggagag  22897200
                                     --------->MYB52(1)
                                     ------->TEIL
                                 --------------->AtSPL3
                            --------->LBD16
                           --------->ATERF1(2)
                           <---------ATERF1(2)
                          <------NtERF2
                          --------->RAP2.3(1)
                          --------->ATERF1(1)
                         ------>NtERF2
                         <---------ATERF1(1)
                         <---------RAP2.6(1)
                         <---------RAP2.3(1)
                         <---------ERF1
                         <---------RRTF1(1)
                        --------->DEAR3(1)
                        <---------DEAR3(1)
                        <---------RAP2.3(2)
                       --------->ATERF1(1)
                       --------->RAP2.3(1)
               <---------ANAC58  <---------YAB5
               <---------ANAC58  <---------------AtSPL3         ----------->HVH21
               <---------ANAC46 <---------DOF5.7(2)             --------->WRKY12
   --------->LBD16    <---------ATERF1(1)             --------->CCA1(2)
   ----------->GT1    <---------RAP2.3(1)            --------->ARR11(3)
 <---------LBD16 <------NtERF2 <---------WRKY12      <---------ARR11(3) <---------MYB52(1)
--------->MYB52(1)   <---------DEAR3(1)      <---------ZAT14    --------->WRKY38(1)
---ZmHOX2a(1)  <---------RAP2.6(2) <---------SPL7(1) <---------RVE1(2) <-------GAMYB          <-----
 
gaagaccggagaaaattggcgtcttcggcgccggtaaacgtaccggactggagtaagatataccgagttgactcggttgagtcaatacacgagttagacg  22897300
<- Previous    Next ->

AGI:  At1g61930.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G11700.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO17934.1); contains InterPro domain Protein of unknown function DUF584 (InterPro:IPR007608)
Range:  from: 22896766    to: 22897641    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version