AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                <---------ANAC46
                                                <---------ANAC58
                                                <---------ANAC58
                                           <---------AHL20(2)
                                           <---------AHL25(1)
                                           <---------AHL12(3)
                                           --------->AHL25(1)
                                           --------->AHL12(3)
                                           <---------AHL25(3)
       --------->DOF5.7(1)                --------->AHL25(1)
      --------->DOF5.7(1)                 <---------AHL25(1)
      --------->DAG2                      <---------AHL12(3)
     --------->DOF5.7(1)                  --------->AHL12(3)
     ---------->DOF2                      <---------AHL20(2)
  <---------AHL25(3)                      --------->AHL20(1)
  --------->AHL20(2)                      <---------AHL20(1)
 --------->AHL20(2)                       --------->AHL20(2)
------>AHL20(1)                           --------->AHL25(2)
-------AHL20(2)                           --------->AHL12(1)
------>AHL20(2)                           <---------AHL12(1)
-------AHL25(1)                           <---------AHL25(3)
------>AHL25(2)                           <---------AHL25(2)
-------AHL25(2)                           --------->AHL25(3)
-------AHL25(3)                          <---------AHL12(3)
------>AHL25(3)                          --------->AHL12(3)
------>AHL25(1)                          <---------AHL25(2)
------>AHL20(3)                          --------->AHL12(2)
-------AHL12(3)                         <---------AHL12(2)
-------AHL20(3)                         --------->AHL12(2)
->AHL20(1)                             --------->AHL12(3)
->AHL20(2)                             <---------AHL20(2)
--AHL20(1)                             <---------AHL12(3)
--AHL20(2)                             --------->AHL20(3)                                          -
->AHL25(3)                             <---------AHL20(3)              <---------ANAC58           <-
->AHL20(3)                            --------->AHL25(3)               <---------ANAC58       ------
--AHL25(2)                           --------->AHL25(1)                <---------ANAC46       <-----
--AHL25(3)             <---------ZAT14<---------AHL25(3)          <-----------RAV1(1)      ---------
->AHL25(2)      <----------DOF2      --------->AHL25(3)           <---------MYB46(3)      <------ZmHOX2a(2)
--AHL25(1)    --------->HSFC1(2)     --------->AHL20(2)      <---------KAN1         <---------AtLEC2
--AHL20(3)    <---------HSFC1(2)     <---------AHL20(2)      <---------ATHB12    ------>ZmHOX2a(1)--
->AHL25(1)   --------->GLK1(2)       --------->AHL12(3)     --------->RVE1(2)    ================HOX2a_HOX2a
 
taaaataaaaaaggagaagctttgtcttcagtgaaaacatataaatttatttcgtatgagacgaatcaattgttgcttgttgtcctagcatggatcactc  18039200
           <---------TOE2(3)
         --------->ICU4                          ---------->DOF2
<---------ICU4--------->ARR14(2)  <------ZmHOX2a(2)
-------->ICU4 <---------ARR14(2) --------->ARR11(3)
--------WOX13(2)                 --------->RVE1(2)   --------->ARR11(3)
--------->AGL15                  <---------ARR11(3)  <---------ARR11(3)                         <---
----------AGL15         ----------->GT1<---------REM1(1)       <-----------RAV1(1)    <---------ARR11(3)
>YAB5 --------->ICU4   --------->DAG2 <---------------------WRI1  <---------MYB46(3)  --------->ARR11(3)
------->WOX13(2)      ---------->DOF2--------->At4g35610       <---------ZAT6     ---------->DOF2
 
taattagtagtaatgaggttttgctaaaagtaacaagatcagttgaagcaaacaaagatgtttttagtgttgttgtttttttggacaaagatgtttttag  18039300
                                             <---------YAB5                  <----------DOF2  <-----
                                   --------->ARR11(3)                       <---------DOF5.7(1)
                                   <---------RVE1(2)                       --------------->AGL15
    <----------DOF2                <---------ARR11(3)               --------->KAN1    <---------DOF5.7(1)
   <---------RVE1(2)      <--------P ------>ZmHOX2a(2)           <----------DOF2     <---------DAG2
------ZAT6              --------->YAB1<----------DOF2         <---------TOE1(2)      <----------DOF2
 
tgtttagctttggttattgtggtacaatggtaagtcttgatctttggagttattgttttaagtcgtagcttttattctctctttatagcttttttttagc  18039400
                                                              <----------DOF2
                                                            <------NtERF2
                                                           --------->LBD16
            <---------AHL20(3)                             ------>NtERF2
           <---------AHL12(1)                              <---------ATERF1(1)
           --------->AHL25(3)                              <---------RAP2.6(3)
           --------->AHL20(2)                             <---------RAP2.6(2)
           --------->AHL12(1)                             <---------ATERF1(2)
     --------->LBD16                                      --------->ATERF1(2)
   <---------LBD16                                   <---------ANAC58
 --------->ARR14(2)       --------->DEAR3(1)         <---------ANAC58
 <---------ARR14(2)      <---------LBD16            ------>ZmHOX2a(2)  --------->YAB1   <-------GAMYB
 <---------ARR11(2)  <-----------HVH21            <---------RVE1(2)  ------->TEIL   <---------ALFIN1
 --------->ARR11(2) <----------DOF2   --------->HSFB2a(2)--------->RAP2.6(3)    --------->RVE1(2)
----At4g35610     ---------->ID1      <---------HSFB2a(2)<---------LBD16    <-----------GT1
 
ttagtatccggagataaatttgtctttcaccggcttagtttttggaagggtttgatccttgccggcttcatgtatcaaaatactatcccaccgttgtaag  18039500
                                ---------->DOF2
                             <---------AHL12(2)
                            <---------AHL20(2)
                            <---------AHL25(3)
                            --------->AHL20(2)
                           --------->AHL20(2)
                          --------->AHL12(2)
                          <---------AHL12(2)
                         --------->YAB1
                        <---------YAB1
                      ----------->GT1
                      --------->YAB5                             ---------->DOF2                   <
                    <---------WOX13(1)                      --------->DOF5.7(1)    <-----------GT1 -
     ------>ZmHOX2a(1)--------->YAB1               ----------->GT1      ---------->DOF2           --
    --------->TOE2(3)<---------YAB5        <----------DOF2  ---------->DOF2  <----------DOF2      <-
  <---------YAB5 <---------ATHB12--------->DAG2 --------->ANAC55(2)--------->DOF5.7(1)  <----------DOF2
 
ttgtaatcctcaatggctcaatgaatgataataaataaagttaactctttcaagtgataaaaaaaaagaaaagaagaaagcttttatcacactttctatc  18039600
                 <---------ANAC58
                 <---------ANAC58                                                                ---
             <XXXXXXXXXXXXXXXXXXXXMIR398B/C                                                    =====
            <XXXXXXXXXXXXXXXXXXXXMIR398A                                                       <----
 --------->AHL20(2)                                                         ----------->GT1    <----
 ----------->TBP <---------ANAC46                                   --------->MYB52(1)         <----
---------------AGL15                                              <---------KAN1--------->DOF5.7(1)
-------------->AGL15                                             --------->GLK1(2)     xxxxxxxxxxxxx
--------------->AGL2                                     --------->MYB52(1)>>>>>>>>>TBF1       <----
----------------AGL3              *TSS     --------->MYB46(3)    --------->RVE1(2)    <---------REM1(1)
 
ccctataaatagaagggatggcttgaagacacatactgaaaacagaacaaacacaaacacaaacagagaatcaacgaagaagaaaaatggtgaaggtgat  18039700
                            --------->GLK1(2)
                           <---------ARR14(2)
                           --------->ARR14(2)
                         ----------->ARR10
                        <------NtERF2
                        --------->ATERF1(1)
                       <---------RAP2.3(1)
                       <---------ERF1
                       <---------ORA47(2)
                       <---------ATERF1(1)
                       ------>NtERF2
                       <---------DEAR4(2)
                      <---------DEAR3(1)
                      <---------ATERF1(2)
                      <---------RAP2.3(3)
                      <---------RAP2.3(2)
                      --------->ATERF1(2)                                                         <-
                      --------->DEAR3(1)                                                          <-
                      <---------ANAC46                                                            <-
                     --------->DREB2C(1)                                                          <-
                     --------->DEAR4(2)                                                           --
                     --------->ATERF1(1)                                                          <-
                     <------NtERF2                                                               <--
                     <---------At4g35610                                                         <--
                     --------->At4g35610                                                         ---
                    <---------ATERF1(1)                                                          ---
                    <---------RAP2.6(1)                                                          <--
                    <---------DEAR4(2)                              <---------ANAC58             <--
                    <---------ERF1                              <---------bZIP60(2)             ----
                    <---------ORA47(2)                          --------->TGA1a                 ----
                   <---------RRTF1(2)                           <---------bZIP60(1)             <---
                   <---------RRTF1(3)                           <---------O2                    <---
                   <---------ANAC46                             <---------TGA1a                <----
                   <---------RAP2.3(2)                          --------->bZIP60(1)            <----
                   <---------RAP2.6(2)                          <---------ANAC55(1)            <----
                   <---------DEAR3(1)                           <---------ANAC58              <-----
     <---------ANAC58<---------ABI4(1)                          =================================bZIP_DOF
     <---------ANAC58--------->RAP2.3(1)                        --------->ANAC55(2)           <-----
  --------->ARR11(2)<---------RAP2.3(1)            <------NtERF2<---------ANAC46             <------
  <---------ARR11(2)<---------RRTF1(1)            ------>NtERF2 <---------ANAC55(2)         --------
  <---------ARR14(2)------>NtERF2 <----------DOF2--------->ALFIN1   <---------ANAC58        <-------
 --------->GLK1(1) <---------RAP2.3(3)          <-----------HVH21  --------->ZAT2          <-------MYC3
 <---------GLK1(1) <---------ATERF1(2)         --------->LBD16  <---------ANAC58--------->ZAT2<-----
 xxxxxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)  --------->PCF5      <-----------------------TaNAC69(2)<--
------>ALFIN1      --------->ATERF1(2)   <---------DEAR3(2)   <---------TGA2(2) <---------ZAT2<-----
=============================================bZIP_DOF        ----------->TGA1   ----------->RAV1(2)
-----bZIP60(2)     <---------DREB2C(2)<-----------GT1        ----------->HVH21  ====================
-----ANAC46     ----------->HVH21 ========================================bZIP_DOF    <----------DOF2
-----TGA1a      <-----------RAV1(1)  ----------->HVH21   --------->DOF5.7(1)    --------->At4g35610<
xxxxxxxxxxxx>smallRNA(fl3) <---------GLK1(2) <---------LBD16<-----------HVH21   <---------At4g35610-
-----O2      <---------RVE1(2)   <---------DOF5.7(1)    --------->DOF5.7(1)    ------->TEIL------->MYC3
 
gtgggtttccgttttagctctggcggcggcgattctccttttgacggtcccggtggcagaaggggtgacgtgctcgcctatgcagctggcttcatgtgcg  18039800
      --------->ANAC55(2)
      <---------ANAC55(2)
      >>>>>>>>>>HY5
      <---------bZIP60(1)
      --------->bZIP60(1)
      <---------TGA2(1)
      --------->TGA2(1)
      <<<<<<<<<<HY5
      <---------O2
      --------->O2
     <-----------STF1
     ----------->STF1
    <---------TGA2(2)
   ----------->HVH21
   ----------->TGA1
<---------DEAR3(1)
--------ATERF1(1)    --------->DEAR3(1)
--------DEAR4(2)    <------NtERF2
--------ERF1       ------>NtERF2
--------RAP2.3(1)  <---------ATERF1(1)
---->NtERF2       --------->RRTF1(3)
--------ORA47(2)  --------->RAP2.6(2)
-------RAP2.3(2)  --------->RAP2.3(2)
-------RAP2.3(3)  --------->DREB2C(2)
------>ATERF1(2)  --------->RRTF1(2)
------>DEAR3(1)   --------->RAP2.3(3)
-------ATERF1(2)  --------->ANAC46
-------ANAC46     --------->ATERF1(2)
-->NtERF2         --------->DEAR3(1)
----->ATERF1(1)  --------->ATERF1(1)                                                            ----
---NtERF2        <------NtERF2<---------ANAC55(1)                                               ----
------ABI4(1)    --------->RRTF1(1)                                                            -----
-----RAP2.3(1)   --------->DEAR4(2)                                                            -----
-----ORA47(2)    --------->ORA47(2)                                                           ------
-----ATERF1(1)   --------->ERF1 --------->ALFIN1                                             <------
----DEAR3(1)     --------->RAP2.3(1)                                                        --------
----RRTF1(2)    <---------ATERF1(1)                    <---------At4g35610                 ---------
---LBD16        <---------RAP2.3(1)        <---------At4g35610                     <---------ARR11(2)
->ALFIN1--------->TGA2(2)     <---------ANAC58         --------->At4g35610         --------->ARR14(2)
----RAV1(1)<---------YAB5     <---------ANAC58         --------->ZAT2              --------->ARR11(2)
----RAP2.3(2)   ------>NtERF2<------NtERF2 --------->At4g35610    <----------DOF2  <---------ARR14(2)
-------DEAR3(1)--------->DEAR3(1)          --------->ZAT2       ----------------->AGL1   ------>MYB83
----RAP2.6(2)  <---------DEAR3(1)          <---------ZAT2--------->RAP2.6(2)      <------ZmHOX2a(1)
====RAV<-----------TGA1    <---------DEAR3(1)       <---------At4g35610    <-------TEIL  ------>MYB46(1)
------NtERF2 <-----------HVH21<---------ANAC46      --------->At4g35610<---------MYB46(3)-------->P
-------->ATERF1(1)<---------ATERF1(2)   ---------->DOF2<---------ZAT2 <---------ANAC46  <---------ALFIN1
 
gcggcgatgacgtcatcgtcgccgccatcggaggcgtgttgcacaaagctgagagagcagcagccatgcctttgtgggtacatgaggaaccctaccctcc  18039900
                                                                                       --------->WOX13(2)
                                                                                     <---------AHL20(2)
                                                                                     --------->AHL20(2)
                                                                                     --------->AHL25(1)
                                                                                     --------->AHL12(1)
        --------->At4g35610                                                          --------->AHL25(3)
       --------->MYB52(2)                                                         --------->ATHB12
     <---------MYB52(1)                                                           <---------ICU4
     --------->DOF5.7(2)                                                          --------->YAB5
    --------->TOE2(3)                                                            <---------YAB5
    --------->TOE1(3)                                                            <---------YAB1
   <---------ANAC55(2)                                                           --------->ICU4
--------->ARR11(2)                                                             <---------ICU4
<---------ARR14(2)                                                             --------->YAB5
--------->ARR14(2)       ---------->DOF2              --------->HSFB2a(2)      --------->YAB1
<---------ARR11(2)    --------->ANAC58            <---------ANAC58            <---------YAB5
-->NtERF2             --------->ANAC58            <---------ANAC58            <---------ATHB12
----->LBD16       --------->ANAC46             --------->GLK1(2)              --------->ICU4<-------
---->ANAC46       --------->ANAC58            <---------GLK1(2)         ----------->GT1<---------WOX13(2)
---->DEAR3(1)     --------->ANAC58           --------->KAN1         <------ZmHOX2a(1)<---------AHL25(1)
--->SPL7(1)     --------->MYB52(1)           <---------HSFB2a(1)  <---------TOE2(3)  <---------AHL12(1)
---ATERF1(1)    ---------->DOF2              --------->HSFB2a(1)  <---------TOE1(3) <---------WOX13(1)
->ANAC46<---------At4g35610           --------->At4g35610  <---------ZAT2   --------->WOX13(1)     -
>MYB46(3)      ----------->HVH21  ----------->RAV1(1) <---------HSFB2a(2)--------->TOE2(3)  --------
 
gccaatacgttagctcccctaacgcaaggaaagtctccaacagttgcaagattccttccccaagctgttaaggaaatgttaatcatgattaattagtgac  18040000
                                                                                  <---------WOX13(1)
                                                                                --------->ATHB12   <
                                                                                --------->YAB5   ---
                                                                               <---------YAB5 <-----
                                                                         --------->ATHB12   <-------
                                                                         --------->YAB5  <---------WOX13(1)
                                                                        --------->ICU4 --------->ATHB12
                                                                        <---------YAB5 --------->YAB5
                                                                      --------->YAB5  --------->ICU4
                                                          <---------AHL25(3)   --------->ICU4 ------
                                                          <---------AHL20(2)   <---------YAB1<------
               <---------MYB46(3)                         --------->AHL20(2)  <---------TOE2(3) <---
              <---------YAB5         <-----------HVH21  <---------AHL12(2)   --------->YAB1---------
        <---------YAB1               <-----------TGA1   --------->AHL12(2) <---------WOX13(1)-------
   <---------At4g35610              --------->ANAC46   --------->YAB1 --------->YAB1  <---------YAB1
--ZAT6--------->YAB5          <---------CCA1(2)       <---------KAN1 <---------YAB1  <---------TOE2(3)
-------->ARR14(2)           <---------DOF5.7(1)     --------->YAB1   --------->ICU4 --------->YAB1 <
--->HVH21--------->YAB1----------------------->TaNAC69(2)<---------YAB1 <---------YAB1<---------YAB5
 
aagtttcgctgattatagtggttaatgctggtcttatcttcgtcactactatttagaataataaatgaagtgatgatgattgatgattgatgattgatga  18040100
<- Previous    Next ->

AGI:  At1g48750.1   
Description:  protease inhibitor/seed storage/lipid transfer protein (LTP) family protein. similar to protease inhibitor/seed storage/lipid transfer protein (LTP) family protein [Arabidopsis thaliana] (TAIR:AT3G18280.1); similar to TED4 [Zinnia elegans] (GB:BAA06462.1); contains InterPro domain Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); contains InterPro domain Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140); contains InterPro domain Plant lipid transfer protein and hydrophobic protein, helical; (InterPro:IPR013770)
Range:  from: 18039635    to: 18040178    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g48760.1   
Description:  DELTA-ADR (DELTA-ADAPTIN); clathrin binding. similar to clathrin binding [Arabidopsis thaliana] (TAIR:AT1G60070.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO68086.1); contains InterPro domain Armadillo-type fold; (InterPro:IPR016024); contains InterPro domain Adaptor protein complex AP-3, delta subunit (InterPro:IPR017105); contains InterPro domain Armadillo-like helical; (InterPro:IPR011989); contains InterPro domain Clathrin/coatomer adaptor, adaptin-like, N-terminal; (InterPro:IPR002553)
Range:  from: 18039654    to: 18043073    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version