AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                 --------->YAB1
                                                                              <---------WOX13(2)
                                                                              --------->WOX13(2)
                                                                           --------------->AGL15
                                                                           <---------------AGL15
      <-----------GT1                --------->ZAT6                       --------->ANAC58
   --------->YAB1                  <-----------GT1             <---------------AGL15
----------->GT1                 --------->AHL12(2)             --------->HSFB2a(2)
-------->RAV1(1)                <---------AHL12(2)             <---------HSFB2a(2)
------>MYB52(1)                 --------->WOX13(2)            ----------------->AGL1          ------
----->AtMYB61                   <---------WOX13(2)            <-----------------AGL1          ------
---->MYB46(3)                 --------->AHL20(2)              <-----------------AGL2          ------
-->ARR14(2)                   --------->AHL25(3)              =============================MADS_MADS
---ARR14(2)                   --------->AHL12(1)   --------->YAB1         --------->ANAC58    <-----
-->ARR11(2)            --------->MYB52(1)--------->YAB1       <-----------------AG            <-----
---ARR11(2)   ---------->DOF2 <---------AHL12(1)--------->WOX13(1)   --------------->AtSPL8   ------
 
caccagtaataactcatcaaagtcaataacagataaattaacactcatgaacaatcacagacatttccagacttggtactcaaataagaacacttcgaat  10224400
                                       ---------->DOF2
                               --------->ARR14(1)
                               --------->CCA1(2)
                              <---------ARR14(2)
                              <---------GATA12
                              --------->GATA12
                              --------->ARR11(1)
                              --------->ARR14(2)
                              <---------GLK1(2)
                        <---------WOX13(2)
                        --------->WOX13(2)
                       <---------AHL25(3)
                      <---------AHL12(1)
                      --------->AHL12(1)
                      --------->AHL25(1)
                      --------->AHL20(3)
                      <---------AHL20(2)
                      --------->AHL20(2)
                      <---------AHL25(3)
                      --------->AHL20(1)
                      <---------AHL20(1)
                      --------->AHL25(2)
          >>>>>>>>>RAP2.2    --------->KAN1
          --------->TOE2(3) <---------TOE2(3)
       --------->WOX13(1)   <---------YAB1
  <---------GATA12    <---------AHL25(2)                   <---------ANAC58
--->ARR14(2)          --------->AHL25(3)          --------->DOF5.7(2)
--->GATA12--------->YAB1<---------AHL12(2)        <---------MYB52(1)
--->RVE1(2)           <---------AHL20(3)        <---------ANAC58    <---------ANAC46
----ARR11(2)          <---------AHL25(1) --------->DOF5.7(1)       <---------TOE2(3)
----ARR14(2)         <---------KAN1    --------->DOF5.7(1) <---------ANAC58                 <-------
--->ARR11(2)        ------->TEIL<-------TEIL    <---------ANAC58<---------WOX13(1)          <-------
 
ccatagatttcaatctaaatacgaatttattaagattcgattaaaagggtttcgttaccttggcgagattgacgtagaagaacaatggtttcttagtgtt  10224500
                                                                 ------>ZmHOX2a(2)
                                                               <---------ARR11(3)
                                                               --------->ARR11(3)
                     --------->HSFB2a(2)                     <---------MYB52(1)
                <<<<<<<<<TBF1                               --------->LBD16
            --------->ARR14(2)                             <---------ANAC58
      <---------GATA12                                     <---------ANAC55(1)                 <----
      --------->GATA12                                     <---------ANAC58  <---------GATA12 ------
      <---------ARR11(2)                                   <---------ANAC46  --------->GATA12 <-----
      --------->ARR14(2)                <-------TEIL       <---------ANAC55(2)                <-----
      <---------ARR14(2)        ------->GAMYB              --------->ANAC55(2)              <-------
----RAV1(1)<---------GLK1(2)   --------->MYB46(3)       ------>ZmHOX2a(1)    ------->TEIL <---------AHL12(1)
--ZAT6--------->ARR11(2)      --------->At4g35610       ================HOX2a_HOX2a       --------->AHL12(1)
 
ggaaacttgaatccgattcttcttctgggtatcaacagccaagttcatgttgttaactccttccgtgatctcttccattgaatctaactcagaaaaatta  10224600
        --------->HSFB2a(2)
        <---------HSFB2a(2)     <---------DOF5.7(1)
      ------>ZmHOX2a(1)        <---------DAG2
-----AHL25(3)                  <---------DOF5.7(1)                                          ------>MYB46(1)
--->AHL20(2)       <---------GLK1(1)                                                        ------>MYB83
----AHL25(1)      --------->GATA12                                               ------->TEIL    ---
----AHL25(3)    <---------TOE2(3) <---------CCA1(2)                         --------->YAB5--------->AtMYB61
--AHL12(2)   <---------KAN1    <----------DOF2    <---------KAN1      --------->CCA1(2)   <---------MYB59
 
aaacttctcctctcgaatttagatttctctctcacttttatctcagaaaacgaatgaaattgaagagacagagagacgacgatgaagcttgaaccaaacc  10224700
                                                                                                 <--
                                                                                                ----
                                                                                                <---
                                                                                                ----
                                                                                                <---
                                                                                                ----
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                                ----
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                               -----
                                                                                               -----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                              ------
                                                                                              <-----
                                                                                              <-----
                                                                                         -----------
                                                                                       <---------ANAC46
                                                                                     <---------LBD16
                                                                                    --------->ALFIN1
                                       --------->ANAC46                           <---------WOX13(2)
                                       --------->ZAT6                             <------------CBF
      --------->TOE2(3)              <-----------GT1                           ------------>CBF<----
      --------->TOE1(3)  --------->ANAC58                                      ----------------->AGL1
  --------->DOF5.7(1)    --------->ANAC46      ------>MYB83                   ----------------->AGL1
 ---------->DOF2         --------->ANAC58      ------>MYB46(1)        ------------>CBF<---------ANAC46
------>LBD16*TSS       --------->MYB52(1)    --------->AtMYB61    <---------ALFIN1--------->WOX13(2)
 
cccaaaaaaccctaacttgaaatgccaaacgacatcgttttaacacaacctacacaaatgggctaggctccagcccaataggcccaattggggggaaaat  10224800
*TSS
-------AHL25(3)
----->AHL25(2)
------AHL25(2)
----->AHL25(3)
------AHL25(3)
----->AHL25(1)
------AHL25(1)
------AHL12(1)
----->AHL12(1)
----->AHL20(2)
------AHL20(2)
------AHL12(3)                      ------>ZmHOX2a(2)
----->AHL12(3)                     <------ZmHOX2a(2)
---->AHL25(2)                     --------->ARR14(2)
---->AHL25(1)                     <---------ARR14(2)
---->AHL12(3)                     --------->GATA12
---->AHL20(2)                     --------->ARR11(3)
-----AHL12(3)                 <------ZmHOX2a(2)
-----AHL25(1)                <-----------HVH21                       <---------YAB1   --------->LBD16
---->AHL25(3)                --------->GATA12        --------->HSFB2a(2)           --------->MYB52(1)
--->AHL12(2)                 <---------GATA12  ------->TEIL       <----------DOF2--------->MYB46(3)
----AHL12(2)           --------->KAN1<-------GAMYB   --------->HSFC1(1)       --------->YAB5
----WOX13(2)   --------->ARR14(2) <---------ARR11(3) <---------HSFB2a(2)     <---------ATHB12   >>>>
>GT1  <----------CDC5 --------->DOF5.7(2)      --------->GATA12  <---------DOF5.7(1)<---------LBD16
-----AHL25(2)  <---------ARR14(2) <---------GATA12   <---------HSFC1(1)    --------->WOX13(1)>>>>>>>
 
taattctgcgatgagcaaaatcggcgttatccgatcagatcgttgaattgaatcttcgagaagactcttcttttgattcaatcactcaccggagaagaag  10224900
                                                                             <------NtERF2
                                                                            <---------ATERF1(1)
                                                                            ------>NtERF2
                                                                            <-----------HVH21
                                                                           <---------DEAR3(1)
                                                                           --------->DEAR3(1)
                                                                   --------->O2
                                                                   --------->ANAC58
                                                                   <---------O2                <----
                ---------->DOF2                                    --------->ANAC58        ---------
          <---------MYB52(1)                                       --------->ANAC46  <---------At4g35610
        <---------DEAR3(1)                                       --------->KAN1      --------->At4g35610
        <---------DREB2C(2)                                     ----------->HVH21    <---------ZAT2
>>>>>TBF1--------->LBD16                                       <-----------HVH21     --------->ZAT2
>>TBF1 <---------LBD16         --------->YAB5                 --------->ANAC46     --------->REM1(1)
 
aagaagctatgccggtgttcaaagctccgttcaatggctactctgtgaaattcagtccattctacgagtcacgcctcgccgtcgctacagctcagaactt  10225000
                  --------->GLK1(2)
                  --------->RVE1(2)
                  --------->ARR14(2)
                  <---------ARR14(2)                    --------->ARR14(2)          <---------ATERF1(1)
                  --------->ARR11(2)                    <---------ARR14(2)          ------>NtERF2
                  <---------ARR11(1)                    <---------ARR11(2)         ----------->HVH21
                <------NtERF2                           --------->MYB52(1)--------->ANAC58
               --------->RAP2.6(2)           <---------GLK1(1)           --------->SPL7(1)
           --------->MYB46(3)                --------->At4g35610   <---------MYB52(1)<------NtERF2
        --------->ARR14(2)                   --------->GLK1(1)<---------ARR14(2)   --------->DEAR3(1)
        --------->ARR11(2)               <---------HSFB2a(2)  --------->ARR14(2)  --------->DEAR3(2)
        <---------ARR14(2)               ------>ZmHOX2a(1)    <---------ARR11(2) --------->At4g35610
        <---------ARR11(2)               --------->HSFB2a(2)  --------->ARR11(2) <---------At4g35610
    <---------LBD16                     <---------LBD16 --------->ARR11(2)--------->ANAC58
    --------->HSFB2a(2)           --------->ZAT18      <---------KAN1    <---------TOE2(2)  --------
    <---------HSFB2a(2)         --------->ZAT2       <---------ANAC58    <---------TOE1(2)  <-------
<---------GLK1(1) --------->GATA12<---------ZAT18    <---------ANAC58  <---------SPL7(1)    --------
--------->GLK1(1) <---------ARR11(2)   ----------->RAV1(2)    --------->GATA12---------->DOF2  -----
-----LBD16--------->DOF5.7(1)   <---------ZAT2   <-----------RAV1(2) <---------------AtSPL3 <-------
>ARR14(2)--------->MYB52(1) ------>ZmHOX2a(1)<---------At4g35610  <-----------HVH21------->GAMYB  <-
 
cggaattctcggaaacggccgaatccatgtcctcgagctcgctcctggagctccaggcgtaactgaatccgtctcgtacgatacagccgacgctgtatac  10225100
                                                  <<<<<<<<<AtERF-3
                                                  <<<<<<<<<AtERF-4
                                                  ------>NtERF2
                                                 <---------RAP2.3(2)
                                                 <---------RAP2.3(3)
                                                 <---------DEAR3(1)
                                                --------->ATERF1(1)
                                                --------->RAP2.6(3)
                                      <------NtERF2
                                      ------>NtERF2
                                      --------->LBD16
      <------MYB83                   --------->RRTF1(3)            --------->ANAC58
      <------MYB46(1)                --------->ANAC46              --------->ANAC46
      <---------MYB46(3)             --------->DEAR3(1)            --------->ANAC58
  <-----------RAV1(1)                --------->RAP2.6(2)         <-----------GT1        ------>ZmHOX2a(1)
 <---------TOE2(2)                   --------->RRTF1(2)       --------->ARR14(2)        ============
 ------->TEIL                        --------->RAP2.3(2)      --------->GATA12        <---------DOF5.7(1)
->ARR14(2)                --------->ZAT14     ----------->HVH21--------->CCA1(2)     ===============
--ARR11(2)   --------->RVE1(2)      <---------LBD16           --------->ARR11(3)     ------>ZmHOX2a(1)
->ARR11(2)   --------->GLK1(2)      --------->RAP2.3(1)       <---------GATA12      <---------ALFIN1
---->ANAC46  <-----------ARR10    --------->DEAR3(1)          <---------ARR14(2)  ==================
--ARR14(2)  <---------GLK1(2)  ---------->CDC5----------->TGA1<---------ARR11(3)  ------>ZmHOX2a(1)
--------ANAC46         --------------------->WRI1<---------RAP2.6(2)      <---------At4g35610
 
gacgtatgttggtcagaatctcatgactctgtgctcatcgccgcaattggtgacggctcagtgaagatttacgacacagctcttcctcctccttctaatc  10225200
                   <-------PIF5
                   ------->PIF5
                   ------->PIF4                                 <-------TEIL
                   ------->MYC2                             <------NtERF2
                   <-------PIF4                            ------>NtERF2
                   <-------MYC3                           <---------ANAC46
                  --------->ANAC58                       <------NtERF2
                  --------->ANAC58                       ------>NtERF2
                 ------------>OsbHLH66                  <---------ATERF1(1)
      --------->KAN4(2)                                 <---------DEAR4(2)
     --------->KAN4(1)                                 <---------DEAR3(1)                      <----
     --------->YAB5------->MYC3                        --------->ANAC46                       <-----
     --------->KAN1<-------MYC2                       ------->MYC3                           -------
     <---------KAN4(1)                                <-------MYC3                        --------->ARR14(1)
    <------ZmHOX2a(2)            --------->GATA12    <---------TGA1a                      --------->CCA1(2)
   --------->ARR11(3)         <-------TEIL           --------->TGA1a                     --------->ARR11(1)
   <---------ARR11(3)      ----------->GT1           <---------O2                        <---------RVE1(2)
   <---------RVE1(2)  --------->TGA1a                --------->ANAC46                   --------->YAB5
===========HOX2a_HOX2a<---------TGA1a                --------->O2                      ----------->ARR10
===========HOX2a_HOX2a<---------ANAC58               <---------ALFIN1                  <---------KAN1
===========HOX2a_HOX2a<---------ANAC58             <---------ALFIN1             <---------ANAC46  <-
 
cgattagatcattccaagagcacgcgcgtgaggttcaatctgtggattacaatcccacgcggcgcgattcgtttctcacttcttcgtgggatgatacggt  10225300
<- Previous    Next ->

AGI:  At1g29250.1   
Description:  nucleic acid binding. similar to nucleic acid binding [Arabidopsis thaliana] (TAIR:AT2G34160.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO65645.1); contains InterPro domain Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); contains InterPro domain Alba, DNA/RNA-binding protein; (InterPro:IPR002775)
Range:  from: 10223252    to: 10224713    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g29260.1   
Description:  PEX7 (peroxin 7). similar to MSI1 (MULTICOPY SUPRESSOR OF IRA1) [Arabidopsis thaliana] (TAIR:AT5G58230.1); similar to pectinesterase-like protein [Brassica rapa] (GB:ABD91573.1); similar to peroxisomal import receptor PTS2 [Brassica napus] (GB:ABB92566.1); contains InterPro domain WD40 repeat-like (InterPro:IPR011046); contains InterPro domain WD40/YVTN repeat-like (InterPro:IPR015943); contains InterPro domain WD40 repeat (InterPro:IPR001680)
Range:  from: 10224801    to: 10226191    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version