AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                 ===================================
                                                                 <------ZmHOX2a(2)                 -
                                                                 ====================HOX2a_HOX2a   -
                                                                 ===========================HOX2a_HOX2a
                                                                --------->AGP1                     -
                                                                --------->ARR11(2)                 -
                                                                --------->ARR14(2)                 -
                                                                <---------ARR14(2)                 -
                               <---------ZAT18                  <---------ARR11(2)                 -
       <-----------RAV1(2)     --------->ZAT18                  --------->RVE1(2)                <--
    --------->YAB1         <------NtERF2                        <---------GATA12           ---------
------->ZAT6            ------>NtERF2                           --------->GATA12           ------->GAMYB
-->NtERF2             <---------RAP2.6(2)             ----------------->AGL2              --------->MYB46(3)
---->RAV1(2)         --------->At4g35610              ----------------->AGL3  ------>ZmHOX2a(1)-----
---At4g35610      ---------->DOF2       ================================HOX2a_HOX2a  ------>ZmHOX2a(1)
-->At4g35610  --------->WRKY18(1)       ------>ZmHOX2a(1)       --------->ARR11(3) <---------DOF5.7(1)
 
gccactagcatcagatggtcaagaagcggccgagtaccctctccttcccaaaaactctccaaaaacagatccagcattgtcctccctccttcaacctcct  10087700
      <----------DOF2
==HOX2a_HOX2a                                                                           --------->KAN1
-------->ANAC55(1)                                                                     <---------ARR14(2)
-------->ANAC55(2)                                                                     --------->ARR14(2)
-------->ANAC46                                                                        --------->ARR11(2)
-------->ANAC58                      ---------->ID1                                    <---------ARR11(2)
-------->bZIP60(2)         <-----------GT1                     <------ZmHOX2a(1)       <---------ARR11(3)
-------->O2               <---------YAB5                    --------->HSFB2a(2)        <---------GLK1(2)
-------->ANAC58         --------->YAB1                      <---------HSFB2a(2) --------->ETT(2)
-------ALFIN1  --------->ATHB12    <-----------RAV1(1)<---------ANAC58    --------->STY1(2)
>AtMYB61       <---------ICU4   <---------MYB52(1)    <---------ANAC58    <---------STY1(2)
->ZmHOX2a(1)  <---------YAB1<---------At5g28300     ------>NtERF2 --------->DEAR3(1)  <------ZmHOX2a(1)
 
ccacgtaagctttgttcaccattgctataatcaccgttttgttgtttcccattgctgccttgtctaggaccgcctctagctcgtccacaggatactctgt  10087800
                                                                                                   -
                                                                                                  --
                                                                                                  ==
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                                ----
                                      <-----------GT1                                           <---
                         --------->ARR11(3)                     --------->DAG2                  <---
                         --------->GATA12                      ---------->DOF2                  <---
                     <---------AHL20(2)                    <---------YAB1                       ----
            --------->ANAC46    ------>ZmHOX2a(1)     --------->GLK1(2)                    <--------
          --------->ZAT6 <-----------ARR10           <---------GLK1(2)                   --------->ZAT14
     --------->WOX13(2)  <---------ARR11(3)        <---------YAB1----------->GT1         <---------ZAT14
--------->RVE1(2)    --------->AHL20(2)       --------->KAN1--------->YAB1              <---------ANAC46
 
ccatctctatttaacacaaaacatttaaaatcttcctatatttactctcaaattccgattctattataaagtaacttacagtttcgacattgtgtagtag  10087900
                                                       --------->DOF5.7(1)
                                                     ---------->DOF2
                                                   <------NtERF2
                                                   --------->LBD16
                                                  --------->ANAC58
         <------ZmHOX2a(2)                        --------->ANAC46
   --------->TOE1(2)                              --------->ANAC58
  <---------KAN1                                 --------->RAP2.3(3)
---------->HVH21                                --------->ATERF1(1)
---->ZmHOX2a(2)                                 <------NtERF2
==============HOX2a_HOX2a                      --------->PCF2
------GATA12                                   ------>NtERF2               --------->LBD16
------RVE1(2)                                  <---------ATERF1(1)        --------->DEAR3(1)
----->GATA12                                   <---------RAP2.3(1)       <------NtERF2
----->ARR14(2)        <---------WOX13(1)      --------->DEAR3(1)        ------>NtERF2
------ARR14(2)       --------->WOX13(2)    --------->DAG2              <---------ALFIN1
------AGP1           <---------WOX13(2)    --------->ANAC46         ------->GAMYB         <------ZmHOX2a(1)
------ARR11(2)    --------->At5g28300      --------->DOF5.7(1)     --------->MYB46(3)  <------NtERF2
----->ARR11(2)   --------->TOE2(3)        ---------->DOF2   --------->DOF5.7(1)       --------->LBD16
-ANAC46<------ZmHOX2a(1)          ----------->GT1<---------LBD16 --------->MYB52(1) <---------LBD16
 
atcggacataggatcagaaaccgtaattgatgagaaatagaaatataaggcgcccgcaaagagaagagcaacggccaccgcgagattgccggaggagttg  10088000
                                                                                           <--------
                                                                                          --------->ARR11(2)
                                                                                          <---------GATA12
                                                                                          --------->GATA12
                                         <-----------GT1                                  --------->ARR14(2)
                                      <---------DOF5.7(1)                                 <---------ARR11(2)
                                     <----------DOF2          --------->ANAC46            <---------RVE1(2)
                                     <---------DAG2           --------->ANAC58        <---------LBD16
                                     <---------DOF5.7(1)*TSS  --------->ANAC58        <-------------
                                    <---------DOF5.7(1)<---------RVE1(2)       <-----------TBP  ----
             <------ZmHOX2a(1)   --------->ZAT18      --------->KAN1        --------->TOE2(3)   <---
       --------->YAB5            <---------ZAT18    <---------MYB52(1)   <-----------GT1  <---------ARR14(2)
      <---------KAN1         --------------->AtSPL8<-------GAMYB  ------------>CBF  <-----------GT1
      --------->ICU4       <---------AHL20(2)     <-----------RAV1(1)   <-----------GT1 --------->LBD16
 
aaggaaggcatgtttaggagactcacctattttatgtgcccttttctctctctctgttgattcgcacacaacaatttaacctatatataaccggatttgg  10088100
                            <---------TOE2(3)
                          <---------AHL25(3)
                          <---------AHL20(2)
                         --------->AHL25(3)
                         --------->AHL20(3)
                         <---------AHL25(2)
                         --------->AHL25(2)
                         <---------AHL20(3)
                         --------->AHL20(2)
       ------>MYB46(1)   <---------AHL25(1)
     <---------MYB46(2)  --------->AHL25(1)
     --------->AtMYB61   <---------AHL20(2)                                        --------->YAB1
    --------->ANAC58     --------->AHL20(1) <---------ANAC46                  --------->ANAC58
    --------->ANAC58   <---------WOX13(2)----------->TGA1                     --------->ANAC46
    --------->ANAC46   --------->WOX13(2)----------->HVH21                    --------->ANAC58
  --------->ZAT6--------->KAN1       <---------YAB1 <---------TOE2(3)       --------->ANAC46
-KAN1<---------MYB111(2) <---------AHL20(1)<---------TOE2(3)         --------->ANAC55(1)          >>
----AG ------>MYB83 ------------>CBF<---------ARR11(3)               <---------ANAC55(2)  <---------
----->GATA12 --------->ANAC58       --------->RVE1(2)                --------->ANAC46<---------YAB5
------GATA12 --------->ANAC58      <---------KAN1   <---------TOE1(3)--------->ANAC55(2) <---------DOF5.7(1)
 
atgtaacaccaaactcaagtcatcccaatttaatgtgaatatcactgacgtttttaaggttccttctctaatacgttacacacgaagcatcatcttttgt  10088200
                                                       --------->TOE2(2)
                                                       --------->TOE1(2)
                                                      --------->YAB1
                                                      --------->KAN1                           <----
                                                     <---------YAB5                            <----
                                                     <---------YAB1                           <-----
                                                   --------->YAB1                             <-----
                                                  <---------YAB1                              ------
                                                 --------->AHL20(3)                     <---------YAB1
                                                 <---------AHL20(3)               --------->GLK1(2)
                                                 --------->AHL12(2)               <---------ARR11(3)
                                                <--------HAHB4                    --------->ARR14(2)
                                                --------->YAB1                    <---------ARR14(2)
                                --------->TOE2(3)<---------AHL12(2)               --------->RVE1(2)
                  --------->ARR14(2)            <---------ICU4                   <---------GLK1(2)
                  <---------ARR14(2)           --------->ICU4  --------->GLK1(2) <---------ARR14(1)<
>>>>>ZML2         ------->TEIL  <----------DOF2<---------YAB1--------->KAN1---------->DOF2----------
-DOF2          --------->ANAC55(2)          --------->LBD16 <---------RVE1(2)--------->DOF5.7(1)<---
 
tctagggtttttgtgtctacgtatttgtatttctactttaatgtctcccgattattatcatgcgatattctattttcccaaagagaatcttataaaagat  10088300
                                                                            ------>ZmHOX2a(2)
                                           <-----------GT1                 <------ZmHOX2a(2)
                                         <---------AHL12(1)               --------->AGP1
                                        --------->AHL12(2)                <---------GATA12
          --------->ANAC55(2)           --------->AHL25(2)  --------->KAN1<---------AGP1
        <-----------GT1                 <---------AHL12(1)  <---------AHL20(2)
        <---------AHL20(2)     <---------ANAC55(2)         <---------ARR11(3)
     <---------ICU4            --------->ANAC55(2)         <---------AHL20(1)            <---------YAB5
-----RVE1(1)                   --------->ANAC58      <-----------GT1      <---------ARR11(3)
-----CCA1(1)                   --------->ANAC46  <---------ARR14(2)       --------->ARR11(3)
----GLK1(2)                    --------->ANAC58  --------->ARR14(2)       <---------RVE1(2)
----ARR11(3)--------->AHL12(1) ----------->GT1   <---------ARR11(3)       --------->GATA12
--->ARR11(3)<---------AHL12(1) --------->ANAC55(1)--------->KAN1<-----------GT1      >>>>>>>>>GATA-1
-----------GT1             --------->MYB52(1)   <---------CCA1(2)        <---------CCA1(2)
>DOF2--------->YAB5       <---------KAN1--------->AHL20(3) --------->AHL25(3)<----------DOF2
------AHL12(1)--------->WOX13(2)        <---------AHL25(2)<---------CCA1(2)<---------RVE1(1)
 
tttttcaatatttacttatttatctcagaataacaggtaacaaaattttccatatattcccatatatttgcctcttagatcttttatagataaacattca  10088400
                                            --------->WOX13(2)
                                         --------->AHL20(2)
                                         <---------AHL25(2)
                                         <---------AHL25(3)
                    <---------ZAT6       --------->AHL12(3)                         <---------WRKY12
                  <---------ANAC46       <---------AHL20(2)                    ---------->DOF2
            <---------TOE2(3)            <---------AHL25(1)             --------->ANAC58
            ---------->ID1               --------->AHL20(3)             --------->ANAC58
          <---------ANAC46               <---------AHL20(3)            --------->DAG2
    <---------TOE1(3)            --------->MYB46(3)     --------->RVE1(2)    --------->AtLEC2
    <---------TOE2(3)    <---------YAB1  --------->AHL25(1)           ---------->DOF2 <---------WOX13(2)
 
gcaattcaaggttttgtggttttgtgttatgtttcaacaaatattaaaatttacagacaaatcacattcaccataaagccatgaaagtcaactaatagta  10088500
                                                                                 <---------AHL20(1)
                                                                                 --------->AHL20(1)
                                                                                 <---------AHL20(2)
                                                                                 <---------AHL25(3)
                                                                                 --------->AHL20(2)
                                                                                 --------->AHL25(2)
                                                                                 --------->AHL25(1)
                                                                                 --------->AHL12(1)
                                                                       ----------->RAV1(1)
                                                                    --------->ANAC58
                                                                   --------->MYB46(2)
                    --------->ANAC58                               --------->MYB59
                    --------->ANAC58                             <<<<<<<<<MYB1   <---------AHL12(1)
                  ---------->DOF2                        --------->AHL25(1)      <---------AHL25(1)
               ----------->GT1                           --------->AHL20(3)      <---------AHL25(2)
               <------MYB46(1)                           <---------AHL20(3)     --------->AHL25(3)
               <------MYB83                              <---------AHL12(3)     <---------AHL25(1)
              <---------MYB46(3)                         --------->AHL12(3)     --------->AHL25(1)
            <---------At4g35610                          --------->AHL20(2)     --------->AHL12(3)
          <---------RAP2.6(2)                            <---------AHL20(2)     <---------AHL12(3)
         --------->RAP2.6(3)                      <-------TEIL   <<<<<<<<<MYB2  --------->AHL20(2)
     --------->AHL20(3)                    ----------->GT1       <---------MYB52(1)
    <---------AHL25(3)                 --------->ANAC58  <---------AHL25(1)--------->ANAC58
    --------->AHL25(3)                 --------->ANAC58--------->AHL20(3)  --------->ANAC58
    --------->AHL20(2)               --------->CCA1(2)<---------ICU4--------->ANAC58   <---------YAB1
 
ctagacataaatttcggctggtaaagccaaacctatagagagacggaagtaaattcatatttatatcagttaggcaacaagaaataaattgtcaatggca  10088600
<- Previous    Next ->

AGI:  At1g28710.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G28700.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN64421.1); contains domain PTHR10483:SF6 (PTHR10483:SF6); contains domain PTHR10483 (PTHR10483)
Range:  from: 10086623    to: 10088057    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version