AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                         <---------MYB52(1)
                        --------->LBD16
                       <---------ANAC55(2)
                       --------->ANAC46
                       ----------->GT1
                       --------->ANAC55(2)
                      ------>ZmHOX2a(2)
                    --------->AGP1
                    <---------GATA12
                    <---------ARR14(2)                                                   --------->GLK1(2)
                    --------->ARR14(2)                                                  <---------ARR14(2)
                    <---------ARR11(3)                                        ----------->GT1
                    --------->ARR11(2)                                        --------->ANAC46
                    --------->GATA12                                          --------->ANAC58
                    <---------ARR11(2)                                        --------->ANAC58
                   --------->KAN1                                             --------->ANAC55(2)
      ----------->GT1<------ZmHOX2a(2)                <---------ARR14(2)      <---------ANAC55(2)
     ------>ZmHOX2a(2)<-------TEIL                   <---------KAN1        --------->DOF5.7(1)
  --------->ATHB12 --------->GLK1(1)            <-------TEIL        <---------KAN1      <---------GLK1(2)
 <---------YAB1    <---------GLK1(1)       <-----------RAV1(2)    --------->YAB1      <---------YAB1
-------->YAB1    --------->LBD16          <------ZmHOX2a(2)   ---------->DOF2 --------->ANAC55(1)  -
 
aaacatgatcggaaaatttccgagatccgtaacttgaaattggcgatcaggttcgagtattcagtaaaagaataacaaaaaacgtaattccgattctgaa  7128500
                                             --------->LBD16
                                           <---------LBD16
                                    <---------YAB5
                                 --------->AHL12(1)
                                 --------->KAN1
                                 <---------AHL12(1)
                                <---------AHL12(2)
                               <---------AHL12(3)
                               --------->AHL12(3)
                               <---------AHL12(2)
                               --------->AHL12(2)          --------->GLK1(2)
                              <---------AHL25(3)    <---------ANAC58
                             --------->AHL25(3)     <---------ANAC58
                             <---------AHL25(1)     <---------ANAC46
                             --------->AHL20(2) <---------GLK1(1)
                             <---------AHL20(2) --------->KAN1
                --------->DOF5.7(1) <-------TEIL<---------At4g35610
         ----------->GT1     <---------AHL12(3) --------->GLK1(1)        --------->YAB1
        ------->TEIL  ---------->DOF2     <---------At5g28300           <---------YAB1            <-
     <---------KAN1 --------->AtMYB61     --------->MYB52(1)  --------->MYB59                   <---
--------->DOF2---------->DOF2--------->AHL25(1)--------->ARR14(2)<--------P                   <-----
 
atgaaagaatgaacgtgaaaagaccaaaagaaataaatattcatttaccggagatgcttgaaaatcaggtagactatgatagcgatgttgaggcgctcgt  7128600
         --------->ATHB12
         --------->YAB1
         <---------ICU4
         --------->YAB5                                               --------->LBD16
        <---------YAB5                                                ------>NtERF2
        <---------YAB1                                              <---------LBD16
     <------ZmHOX2a(1)                                        <---------CCA1(2)            <--------
    <------MYB83                                            <---------ALFIN1               ---------
    <------MYB46(1)                                       <------NtERF2                    ---------
   --------->MYB59                                       --------->ANAC46                  <--------
  <--------P                                             --------->ANAC58                <---------MYB46(3)
<------MYB83--------->KAN1                               --------->RAP2.6(2)             --------->MYB55(2)
<------MYB46(1)                          <---------AtMYB61------>NtERF2                  --------->ABI4(2)
-------P--------->ICU4--------------->AtSPL8             --------->ANAC58               --------->ALFIN1
------REM1(1) <---------YAB1           <----------DOF2  --------->SPL7(1)          --------->MYB52(1)
--GAMYB <---------KAN1<---------------AtSPL3          <---------SPL7(1)            <---------DOF5.7(2)
 
tgtaggtaggaatgattatgctatacttgtacttcttctctcctttggtctccatctcgtccgccatctcttccggcgagttttggtaacggtggttcct  7128700
                                                   ----------->GT1
                                               --------->AHL20(3)
                                               <---------AHL25(2)
                                               --------->AHL25(2)
                                               <---------AHL20(3)
                                              --------->YAB1
                                            <---------AHL12(3)                                     -
                     --------->ATERF1(1)    --------->AHL20(2)                                     <
                     <------NtERF2          <---------AHL20(2)                                     <
        <-----------HVH21                   --------->AHL25(1)                                     -
        --------->LBD16                     <---------AHL20(3)                   <-----------------AGL3
       ----------->GT1            *TSS      --------->AHL20(3)                   <-----------------AGL1
       <---------ANAC55(2)        --------->YAB1 <---------ICU4         --------->ANAC58           -
<---------DOF5.7(1) <-----------HVH21       <---------AHL25(1)          --------->ANAC58           <
-ARR14(2)           <---------RAP2.6(3) --------->YAB5                 --------->DAG2              -
>ARR11(2)          --------->DEAR3(1)   <------ZmHOX2a(1)             --------->DOF5.7(1)    <------
>ARR14(2)        --------->At4g35610   --------->ICU4                 ---------->DOF2 <------------CBF
-ARR11(2)        <---------At4g35610  <---------TOE2(3)        <----------ID1    <-----------------AGL2
 
tcgtcttaacccgtgaaatcagccgtcgtctgtacaaaaataaggattaaaataatgtcaaatatagggactaaaaagcaagtttctcaaattgggccta  7128800
                                     ---------->DOF2
                              --------->WOX13(1)
                             <---------AHL25(3)
                             --------->AHL12(1)
                             <---------AHL12(1)
                             <---------AHL20(2)
                             --------->AHL20(2)
                            --------->AHL12(3)                           *TSS
 <---------AHL20(3)         <---------AHL25(1)                        <---------At4g35610          <
-------->AHL20(2)           --------->AHL25(3)                        --------->At4g35610     ------
---------AHL25(1)           --------->AHL20(2)                        ----------->RAV1(2)     ------
---------AHL20(2)           --------->AHL25(1)                 --------->WOX13(1)            -------
---------->TBP  ---------->DOF2     <------ZmHOX2a(1)  --------->KAN1 <---------KAN1         -------
-------->AHL25(1)          --------->AHL12(2)      ----------->GT1   --------->GATA12        -------
---------AHL12(3)          <---------AHL12(2)   --------->DOF5.7(1)  <---------GATA12<----------DOF2
-------->AHL12(3)         --------->YAB1  <----------DOF2   <-----------HVH21       <---------DOF5.7(1)
---MYB59     ----------->TBP<---------AHL12(3)---------->DOF2------------>CBF    <---------DOF5.7(1)
 
atataaatatgggcctatataaagcccaaaaataaatcaggaaagctttaaaagaggtaaactcgtcaatcgcatctgagtcgctcttctttccttccgc  7128900
      <----------DOF2
   <-----------GT1
--------->AHL20(3)
<---------AHL20(2)
---------DOF5.7(1)                                 <---------ANAC46                          -------
--->LBD16                                    <---------TOE2(3)                               <------
>NtERF2                                      <---------TOE1(3)                           -----------
-->ANAC58                                --------->WOX13(2)         --------->At4g35610--------->LBD16
-->ANAC46               ---------->DOF2  <---------WOX13(2)   --------->DOF5.7(1)   --------->MYB52(1)
-->ANAC58           <---------ZAT6      --------->WOX13(1)  ---------->DOF2        <---------KAN1
 
catttttttctttctaggttgcagagttaaaggagaaggttttcaattagggttttgtagagagaaagatgagccgaagtttgggaataccggtgaagct  7129000
                            --------->ALFIN1
                         <---------ANAC46
                         <---------DEAR3(1)      <----------DOF2        <---------ZAT6
          <-----------RAV1(2)   --------->At4g35610                   <---------ANAC58         -----
         <------NtERF2   <---------DREB2C(2)--------->DEAR3(1)        <---------ANAC58         <----
  --------->ANAC46    ----------->TGA1     <------NtERF2              <---------ANAC46     <--------
  --------->O2        ----------->HVH21  <---------DEAR3(1)        <---------WOX13(1)    <----------
  <---------O2      <---------ANAC58 --------->DOF5.7(1)         --------->YAB5        <---------ARR11(2)
-->HSFC1(2)      <---------CCA1(2) ---------->DOF2               --------->ATHB12      --------->ARR11(2)
---HSFC1(2)  <-----------HVH21  <---------At4g35610             <---------YAB1  <---------KAN1 -----
>HVH21------>NtERF2 <---------ANAC58 ---------->DOF2      <------ZmHOX2a(1)   <------ZmHOX2a(1)<----
 
tcttcacgaggcctcaggtcatatcgtgacggtggagctaaagagcggcgagctttacagaggaagtatgattgagtgtgaggataactggaactgtcag  7129100
                                              <------ZmHOX2a(2)
                                             --------->GATA12
                                             <---------GATA12
    <---------KAN1                           <---------AGP1
   <---------ARR14(2)                        --------->RVE1(2)
   --------->ARR14(2)                        <---------ARR14(2)
   --------->ARR11(3)                        --------->ARR14(3)
   <---------ARR11(3)                        <---------ARR14(3)
   <---------RVE1(2)                         --------->ARR11(3)
  <------ZmHOX2a(1)                          --------->ARR14(2)
---->ZAT2                          --------->KAN1         <---------AHL20(2)
-----ZAT2                     <---------At4g35610        --------->AHL20(2)
---HVH21 <---------ANAC55(2) --------->MYB52(1)------>ZmHOX2a(2)
--AtMYB77<---------ANAC46  <---------YAB5    <---------ARR11(3)                           <---------ANAC58
---->At4g35610   ------>NtERF2--------->At4g35610    <---------YAB5                       <---------ANAC58
-----At4g35610<---------At5g28300 <---------RVE1(2)  <-------TEIL                   <---------TOE2(2)
 
ctcgaggatattacttataccgccaaggtaatcaactgatactctgaagatctcgattcattttatatgagactgttttttgaaccataggtttcgtttc  7129200
                                           --------->ZAT2
                                           <---------ZAT2
                                           <---------At4g35610
                                           --------->At4g35610
                                      <------MYB83
                                  <---------GATA12
                                  --------->GATA12
                                  <---------ARR14(2)
                                  --------->ARR14(2)                                <---------AHL20(2)
                     <-------GAMYB--------->ARR11(1)--------->GATA12       <---------ANAC58
          <---------TOE2(3)     ----------->ARR10   --------->ARR14(2)  <---------WOX13(1)
 <XXXXXXXXXXXXXXXXXXXXXXXMIR829.1 <---------GLK1(2) <---------GATA12 <---------TOE2(3)
<---------YAB1      ----------->GT1   <------MYB46(1)    <---------ANAC46  <---------ANAC58
<---------AHL20(2)<---------ZAT18 <---------RVE1(2) <---------ARR14(2)<<<<<<<<<RAP2.2
 
aatttcattgtttgatgttagtgctgttaaaaccctagatttggtgagctgggcaaatttgctgggaaattttagattgcttcttattttaagttctaag  7129300
                                                                                   <---------ANAC46
                                                                               --------->ZAT14
                                                                      <---------AHL12(2)
                                                   ------>ZmHOX2a(1) --------->AHL12(3)
                                                 ------>ZmHOX2a(2)   <---------AHL12(3)
                                               <---------ARR11(3)    <---------AHL12(2)
                                               --------->ARR11(3)    --------->AHL12(2)
                  <-------TEIL             <---------ANAC46         --------->AHL20(2)
          --------->TOE2(3)                <---------ANAC58         <---------AHL12(1)            --
       --------->GLK1(2)----------->GT1    --------->ANAC55(2)      --------->AHL25(3)           <--
       --------->ARR14(2)                  <---------ANAC58 --------->KAN1     <---------ZAT14 =====
       <---------ARR14(2)                  <---------ANAC55(2)      --------->AHL12(1)         <----
    <---------TOE2(3)   <---------ANAC46 <---------KAN1  ----------->HVH21<---------YAB1       -----
 
tgagattaagaatccttgaaattcatgctgtataaaaccctagaatgcgtgatcctgccagtgacattagataaattttgactgtagggtatagtctcct  7129400
<- Previous    Next ->

AGI:  At1g20575.1   
Description:  dolichyl-phosphate beta-D-mannosyltransferase, putative / dolichol-phosphate mannosyltransferase, putative / mannose-P-dolichol synthase, putative. similar to glycosyl transferase family 2 protein [Arabidopsis thaliana] (TAIR:AT2G39630.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO62025.1); contains InterPro domain Glycosyl transferase, family 2 (InterPro:IPR001173)
Range:  from: 7126762    to: 7128735    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g20580.1   
Description:  small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative. similar to SMD3 (SNRNP CORE PROTEIN SMD3) [Arabidopsis thaliana] (TAIR:AT1G76300.1); similar to unknown [Picea sitchensis] (GB:ABK21888.1); contains InterPro domain Like-Sm ribonucleoprotein, core; (InterPro:IPR001163); contains InterPro domain Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core; (InterPro:IPR006649); contains InterPro domain Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920)
Range:  from: 7128874    to: 7130632    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version