AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                             --------->ALFIN1
                           --------->ALFIN1
                         --------->ANAC55(2)
                         <---------ANAC58
                         <---------ANAC55(2)
                         <---------ANAC46
-------ARR11(2)          --------->O2
------>RVE1(2)           <---------ANAC55(1)
------>ARR14(2)          <---------ANAC58                         --------->ARR14(2)
-------ARR14(2)          --------->TGA1a                       --------->YAB1                  -----
------>ARR11(2)          <---------O2                         <---------YAB5                  <-----
------CCA1(2)            <---------TGA1a                    --------->YAB1                 <--------
------ARR14(1)        <---------MYB52(1)                    --------->WOX13(1)          <---------ALFIN1
------KAN1           <-----------HVH21  <---------YAB1   --------->TOE2(3)            <---------At5g28300
-GT1           <---------MYB52(1) --------->GLK1(1)<-----------GT1<---------ARR14(2) <-----------GT1
 
tatccaaattgtttatctgttaactgttacgtgtgggaactctatgatttagtttatccacattaatcagaccctcaaacatttacatttaccacctcct  3945300
     <---------AHL20(2)
     --------->AHL20(2)
     <---------AHL25(3)
     --------->AHL12(3)
     <---------AHL25(1)                           --------->ARR11(3)
     --------->AHL25(1)                     --------->CCA1(2)
    <---------AHL20(2)                      --------->KAN1
    --------->AHL25(3)                     --------->ARR11(2)
   --------->AHL12(2)                      <---------ARR14(2)
<---------AHL20(3)                         <---------ARR11(2)
--------->AHL25(3)                         --------->ARR14(2)
--------->AHL12(3)                         <---------RVE1(2)
<---------AHL20(2)                         <---------ARR11(3)
<---------AHL20(1)                  --------->GLK1(1)
--------->AHL20(2)                 --------->GATA12
--------->AHL20(3)                 <---------GATA12<------ZmHOX2a(2)
--------->AHL25(2)                 <---------GLK1(2)
--------->AHL25(1)                 --------->ARR14(2)             <---------ANAC58
<---------AHL25(2)                 --------->ARR11(2)             <---------ANAC58        --------->CCA1(2)
<---------AHL25(1)                 <---------ARR14(2)             --------->ANAC55(2)  --------->DOF5.7(1)
<---------AHL25(3)                <---------At4g35610       --------->GLK1(2)   --------->DOF5.7(1)
->ZmHOX2a(1)                      --------->KAN1  <---------ARR11(3) --------->ATHB12---------->DOF2
----DOF5.7(1)           --------->ZAT14<---------LBD16     <---------GLK1(2)  ---------->DOF2
-ALFIN1               <---------DOF5.7(1)--------->LBD16  --------->KAN1   <---------TOE2(3)
 
tattttatttatttctaaatagaccccttcactattcagattcccagatatgagatcacagagattcttacttgatttgacgaaagacaaaagagatggt  3945400
                                                                      <---------ANAC58
                                                                      <---------ANAC58
                                                          <---------ANAC55(2)
                                                          <---------ANAC46
         <-------TEIL                                     <---------ANAC58
      --------->AHL12(1)                                  --------->ANAC55(2)
      --------->KAN1                                      <---------ANAC55(1)
    <---------AHL12(2)                                    <---------ANAC58
    --------->AHL12(2)                                   --------------->AtSPL3<---------DAG2
   <---------AHL25(3)                                    --------------->AtSPL8<----------DOF2
  --------->AHL20(2)                              --------->ANAC46 <----------DOF2               <--
  <---------AHL25(3)                              --------->ANAC58<---------DOF5.7(1)       --------
  <---------AHL20(2) <---------WOX13(2)           --------->ANAC55(2) <---------ANAC46 --------->AtLEC2
--------->WOX13(2)  --------->KAN1   <---------AHL12(2) <-----------GT1 --------->AtLEC2   ---------
<---------WOX13(2) <----------DOF2 <---------KAN1 --------->ANAC58<---------DAG2  <-----------GT1<--
 
ctaaattaaaaattcgtttgcgcttattagatggcagaatattaaacacattcacgaaattacgtactacctttcgtgcaaactttttccatccaaaagt  3945500
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                               <---------WOX13(2) <-
                                                                   <---------YAB1              <----
                                                                  <---------AHL20(2)           <----
                                                                  --------->AHL20(2)           -----
                                                                  --------->AHL25(1)           <----
                                                                  <---------AHL12(3)           -----
                                                                  <---------AHL25(1)           -----
                                                                  --------->AHL25(2)           -----
                   ------->GAMYB                                  <---------AHL25(3)           <----
                --------->MYB52(1)                                <---------AHL25(2)           <----
            <---------GATA12                           <---------GLK1(1)      --------->KAN1   <----
          <---------AHL20(2)                          <---------GATA12   <---------TOE2(3)   -------
     <---------AHL20(1)   --------->ANAC58      --------->ZAT6    --------->AHL12(3)     --------->YAB1
     --------->AHL20(1)   --------->ANAC58      --------->YAB5   --------->AHL20(2)     ----------->GT1
----MYB83 <---------AHL25(3)               --------->ANAC58      <---------AHL25(3) --------->ARR11(3)
->DAG2   --------->AHL20(2)                --------->ANAC58    <---------WOX13(2)   <---------RVE1(2)
->DOF2   <---------AHL25(1)        --------->RVE1(2)  --------->GATA12   <---------TOE1(3)  --------
----MYB46(1)--------->GATA12<---------GLK1(2)<------ZmHOX2a(1) --------->WOX13(2)   <---------ARR11(3)
 
tggttttatatattaaatccaacggtggaaagaaactctatcaaacaaggaccactagatttcagaaattaaaattagggtttattagatattgataata  3945600
    <---------ANAC58
    <---------ANAC58
    <---------ANAC46
---->ARR11(3)
-----ARR11(3)
---->AHL20(2)
---->AHL25(2)
---->AHL12(1)
-----AHL25(1)                                          <---------YAB5
--------AHL20(2)                                <---------AHL25(1)
-----AHL25(3)                                   --------->AHL25(2)
-----AHL25(2)                                   --------->AHL25(3)
---->AHL25(3)                                   --------->AHL25(1)
-----AHL20(3)                                   --------->AHL20(2)
---->AHL20(3)                --------->ATHB12   <---------AHL25(2)
---->AHL25(1)               <---------YAB5      <---------AHL20(2)                              <---
---->AHL20(1)               --------->ICU4      --------->AHL20(3)                              ----
-----AHL20(1)               <---------YAB1      <---------AHL20(3)                             <----
-----AHL20(2)             <---------ICU4     <---------ARR11(3)                   --------->At4g35610
-----AHL12(1)            --------->ICU4      --------->ARR11(3)     <----------DOF2        ---------
-->AHL12(2)            --------->YAB1        <---------RVE1(2) --------->KAN1     <---------At4g35610
->AHL20(2)            <-------TEIL         <---------TOE2(3) <-----------GT1   <---------At4g35610--
 
tattatggggtgtttttgtaagaaattcataatgagtggtatagttgagattttatttgtcatttcacattcttttggactcttctgcttacaaaaatgc  3945700
                                                                                                   <
                                                                                                   -
                                                                                                   <
                                                                                                  <-
                                                                                                 <--
                                                                                                 ---
                                                                                                 <--
                                                                                                 <--
                                                                                                 ---
                                                                                                 ---
                                                                                                 ---
                                                                                                 <--
                                                                                                 <--
                                                                                                 <--
                                                                                                 ---
                                                                                                 ---
                                                                                                 <--
                                                   <---------ANAC55(2)       --------->YAB5      ---
                                                   --------->ANAC55(2)       <---------ICU4      ---
                                                 <---------AHL20(2)       --------->YAB1         <--
                                                 <-----------GT1        <---------ARR11(3)      ----
------------AGL15                                --------->AHL20(2)     --------->ARR11(3)      ----
----------->AGL15                              <---------WOX13(2)      --------->YAB1          <----
-------------AGL2                         --------->RVE1(2)           <---------TOE2(3)    ---------
>KAN1<---------YAB5             ---------->DOF2--------->WOX13(2)     <---------YAB1--------->RVE1(2)
--------->TBP     <---------MYB52(1)*TSS<---------ARR11(3)       --------->YAB5 --------->YAB1 -----
 
tatatatagtcgtccatttcccttcgtttaaaacttatagcgaaatctctaattacttaatctctgaatgcttaagataataactataatctaagagtaa  3945800
 <---------AHL20(2)
 --------->AHL20(2)
 <---------AHL25(1)
---------WOX13(2)
-------->WOX13(2)
---------AHL12(2)
--------AHL25(3)
-------AHL20(2)
------>AHL20(1)
-------AHL20(1)
-------AHL12(3)
------>AHL20(2)
------>AHL12(3)
------>AHL25(1)
-------AHL25(2)
-------AHL12(1)
-------AHL25(3)
------>AHL12(1)                                                        <----------CDC5
------>AHL25(3)                                                       --------->YAB5
-------AHL20(3)                                                    --------->MYB52(1)
------>AHL25(2)                                                   ----------->HVH21
------>AHL20(3)                                                   ----------->TGA1
-------AHL25(1)                                                 --------->ZAT2
----->AHL12(2)             <---------TOE1(3)                    <---------ZAT2
----->AHL25(3)             <---------TOE2(3)                    --------->At4g35610                <
-----WOX13(2)----------->GT1----------->GT1                     <---------At4g35610         --------
-->GT1--------->YAB5      xxxxxxxxxxxxxxxx>smallRNA(se3)      xxxxxxxxxxxxxxxxxxxx>smallRNA(le3)<---
---->WOX13(2)<---------MYB46(3)  ---------->DOF2             ---------->DOF2                --------
 
ttaattaaacgataagtggttaaatttgttgaggttaaaagtgaagcttcaatggcaagaggtcgaaagctgacgatgagccagagcgagaggtacctag  3945900
                                       --------->At1g77200
                                       --------->DEAR3(1)
                                       --------->DREB2C(2)
                                       ----------->HVH21
                                       ------->GAMYB
                                      --------->DEAR3(2)
                                      <------NtERF2
                                     <---------ATERF1(1)
                                    --------->DEAR3(1)
                                   --------->MYB46(3)
                                  ------>NtERF2
                                  <---------ATERF1(1)
                                  --------->LBD16
                                  <-----------HVH21
                                 --------->ANAC58
                             --------->HSFB2a(1)                                           ---------
                             --------->HSFC1(2)                                       <-----------HVH21
                             <---------HSFB2a(1)                                  ------>NtERF2    -
                             <---------HSFC1(2)                                  --------->DEAR3(1)<
                           --------->ARR11(2)                       <---------At4g35610<------ZmHOX2a(2)
                           <---------ARR11(2)                      --------->GATA12 <---------ETT(2)
                           <---------GLK1(2)                       <---------GATA12<------NtERF2   -
                           --------->ARR14(2)                   <------ZmHOX2a(1)<---------ANAC46  <
                           <---------ARR14(2)                   ==============================HOX2a_HOX2a
                         ------->GAMYB--------->MYB46(3)--------->ANAC46      --------->ANAC46    --
               ----------->HVH21 --------->ANAC58      <---------LBD16        --------->ANAC58  ----
              --------->At5g28300--------->ANAC46     --------->MYB52(1)    <xxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
  --------->At4g35610  >>>>>>>>>MYB98------>NtERF2 --------->At4g35610      <---------ALFIN1   -----
  xxxxxxxxxxxxxxxxxxxx>smallRNA(le3)<---------ALFIN1 ----------->HVH21  <-----------HVH21 <xxxxxxxxx
---------At4g35610    --------->MYB52(1)           <---------At4g35610 xxxxxxxxxxxxxxxxxxxx>smallRNA(l2)
->TOE1(2)   <---------ANAC46--------->KAN1    <---------KAN1 <------ZmHOX2a(1)--------->ANAC58<-----
---ZmHOX2a(1)xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)    --------->ZAT2 <---------KAN1 xxxxxxxxxxxxxxxxxxx
->TOE2(2)  <---------At5g28300  <---------LBD16--------->YAB1=================================HOX2a_HOX2a
 
gaagcagctatagttacggtgacagtaacggaaactccgccaccgacgaatcagagctcacggaggaggacatctggtcacacgccgtcgatcacagccc  3946000
                                                                    <---------ANAC58
                                                                  --------->MYB55(2)
                                                                  <---------MYB46(3)
                                                                 <---------AtMYB61
                                                               <------MYB46(1)
                                                               <------MYB83
                                                               <---------MYB46(3)
                                                              <---------AtMYB61
                                                              <---------DEAR3(1)
                                                              --------->ALFIN1
                                                           --------->MYB55(2)
                                                           <---------MYB46(3)
                                                          --------->ALFIN1
                                                         <-------MYC2
                                                         ------->MYC3
                                                         <-------MYC3
                                                         ------->MYC2
                                                         ------->PIF5                       <-------
                                                        <---------ANAC58                    <-------
                                                        --------->TGA1a          <-------GAMYB
       <---------GLK1(2)                                <---------ANAC58       <---------ANAC46
 --------->GLK1(2)                                      --------->ALFIN1       <---------ANAC58
>DEAR3(1)                                               <------NtERF2          <---------ANAC58
-------->KAN1                                           <---------TGA1a       <------NtERF2---------
---------GLK1(1)              --------->ANAC55(2)       =================================MYC_MYB
-------->GLK1(1)              --------->ANAC46         ------>NtERF2<---------ANAC58   =============
---------At4g35610            --------->ANAC58        <---------ANAC58     --------->ATERF1(1)  ----
------->ARR14(2)              --------->ANAC58   xxxxxxxxxxxxxxxxxxxx>smallRNA(le3)    <------ZmHOX2a(1)
----->LBD16          --------->ALFIN1          <------ZmHOX2a(1)<xxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
---->LBD16         <---------ANAC58     --------->ALFIN1<---------ANAC46  <---------At4g35610   <---
xxxxxxxsmallRNA(s) <---------ANAC46     <---------AtMYB61<-------PIF5 <-----------RAV1(1)  ---------
----LBD16xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)<---------ANAC46<---------DEAR3(1)------>NtERF2 ---------
x>smallRNA(le3)    <---------ANAC58   <---------ANAC46<---------ANAC58--------->MYB52(2)   ---------
 
ggagatgctggaatctcatggagcgtggaacacacgcgatgctgtggtgaggaatgggcgcgtgggtggtggtttgtcgctggcgtttgaggacgcgtca  3946100
                       <---------ANAC58
                       <---------ANAC55(1)                                                     <----
                       <---------TGA1a                                                         <----
                       <---------O2                                                           ------
                       --------->TGA1a                                                       <------
                       --------->ANAC55(2)                                                   <------
                       <---------ANAC46                                                     <------NtERF2
                       <---------ANAC58                                                     --------
                       <---------ANAC55(2)                                                  <-------
                       --------->O2                                                        <--------
                      <-------TEIL                                                         <--------
                    --------->ARR11(2)                                                     <--------
                    <---------ARR14(2)                                                     ------>NtERF2
             --------->ZAT14                                                              xxxxxxxxxx
             <---------ZAT14                                                              <---------DEAR3(1)
             --------->ZAT18                                                              <---------RAP2.3(3)
             <---------ZAT18                                                             --------->ATERF1(1)
          xxxxxxxxxxxxxxxxxxxx>smallRNA(le3)                                             <------NtERF2
          <---------ANAC58       <------ZmHOX2a(1)                                      <---------SPL7(1)
          ====================================HOX2a_HOX2a                               <-----------HVH21
          <---------ANAC58    <------NtERF2                                             <---------ATERF1(1)
        <---------ARR14(2)    --------->ATERF1(1)                                      <---------O2
        --------->GATA12     --------->LBD16                                           --------->O2
        --------->ARR11(3)  <---------ANAC58                                           <---------DEAR3(1)
        <---------GATA12 ----------->HVH21          --------->ALFIN1                  <------NtERF2
    --------->LBD16 --------->ARR14(2)            <---------MYB46(3)                  --------->ATERF1(1)
    ------>NtERF2   <---------ARR11(2)           <---------DEAR3(1)                  <-----------HVH21
   --------->DEAR3(1)--------->CCA1(2)           --------->ALFIN1                   <---------ANAC46
xxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)              <---------AtMYB61                  <---------ANAC58
----TGA1--------->ARR14(2)  <---------DEAR3(1)<---------AtMYB61                     <---------ANAC58
----HVH21 ------>ZmHOX2a(2) <---------ANAC46  --------->ALFIN1                 <---------At4g35610
>bZIP60(2)==============================HOX2a_HOX2a <---------ANAC46           --------->At4g35610
=================HOX2a_HOX2a<---------ANAC58 <------ZmHOX2a(1)                 <---------ZAT2-------
----->At4g35610     <---------GLK1(2)  <------ZmHOX2a(1)                       --------->ZAT2-------
------At4g35610----------->RAV1(1)    --------->DOF5.7(1) --------->ALFIN1     <-------GAMYB--------
>ANAC58 <---------ARR11(2) <------NtERF2--------->ALFIN1 <------ZmHOX2a(1) ------------>AtMYB77<----
>ANAC46 --------->ARR11(2) <---------LBD16 --------->ALFIN1    <------ZmHOX2a(1)   <------NtERF2   -
>ANAC58<------ZmHOX2a(1) --------->ALFIN1 <------ZmHOX2a(1) <------ZmHOX2a(1) <---------MYB46(3) ---
 
tcttcgccgaggatcgtgcaccagatacgtggcggaggagaaggaggaggaggtggtggaggaggaggaagagttgagaggcagttggcgtcgtcggctc  3946200
<- Previous    Next ->

AGI:  At1g11700.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G61930.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO17934.1); contains InterPro domain Protein of unknown function DUF584 (InterPro:IPR007608)
Range:  from: 3945737    to: 3946613    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version