AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                         ---------->DOF2
                                                                                    --------->RVE1(2)
                                                                                  --------->HSFB2a(1)
        --------->ANAC58                                                          <---------KAN1
        --------->ANAC58                           --------->DOF5.7(1)            --------->KAN4(1)
    --------->RVE1(2)                    --------->At4g35610      <----------DOF2 <---------KAN4(1)
 --------->ANAC58                   <---------At4g35610          <---------ANAC58 --------->MYB46(3)
 --------->ANAC58                   <-------GAMYB---------->DOF2 <---------ANAC58 <---------HSFB2a(1)
------>YAB1                         --------->At4g35610 ---------->DOF2----------------->AGL1
----GLK1(1)             <----------ID1   <---------At4g35610 <----------DOF2     <---------KAN4(2)
 
tcacaagtatcaagcatcgaactcaaaacaacaaattgcagttgagcttcacaaaagaagaaagctttgcttttgcctattgggaacaatccaaaagtcc  3615800
                                                               <----------DOF2
                                                               --------------------->WRI1
                                                              <---------DOF5.7(1)
                                                             <---------DOF5.7(1)     --------->YAB5
                                    <---------ICU4      --------->GLK1(1)            --------->YAB1
                                    --------->YAB5      <---------GLK1(1)           <---------YAB1
           --------->AHL20(2)       --------->YAB1     <---------ARR11(3) --------->RVE1(2)
        --------->YAB1             <---------YAB1  ---------->DOF2      --------->GLK1(2)
       <---------YAB5       --------->ATHB12   --------->RVE1(2)        --------->RVE1(2)
     --------->YAB1   <----------DOF2--------->ARR11(3)--------->ARR11(3)<---------KAN1      -------
   --------->WOX13(2)<---------DOF5.7(1)       --------->GLK1(2)       <---------GLK1(2) --------->KAN1
 
cgtttcaataaacataaaatacttcctttcttcatttgatgatcacgaagaatctaaagaactcccctttctaagaatctcaaacttatgataaatcctt  3615900
                                         --------->YAB1
                             <-----------GT1
                           <---------AHL25(2)
                           --------->AHL25(2)
                          --------->AHL12(1)
                          <---------AHL12(1)
                          <---------AHL12(2)
                          <---------AHL25(1)
                          --------->AHL25(1)
                          --------->AHL12(3)
                          <---------AHL12(3)
                          <---------AHL25(3)
                         <---------AHL20(3)
                         --------->AHL20(1)
                         <---------AHL12(1)
                         --------->AHL12(2)
                         --------->AHL25(3)
                         --------->AHL20(3)
                         <---------AHL25(2)
                         --------->ARR11(3)
                         <---------ARR11(3)
                         --------->AHL12(1)
                         --------->AHL25(2)                                                     ----
                     <------ZmHOX2a(1)  <---------ATHB12                                --------->KAN1
                <---------ALFIN1  <----------DOF2                                      <---------YAB5
       --------->LBD16   <---------AHL20(1)           ----------->RAV1(2)          --------->DOF5.7(1)
 --------->DOF5.7(1)----------->GT1   --------->WOX13(1)       ------>ZmHOX2a(1) ---------->DOF2----
-->TOE1(2)--------->GLK1(1)<---------AHL25(3)    <-----------GT1            ---------->ID1<---------YAB1
 
ggaaaaaatcccgatttctccacaggaaaatatttctctttcaatcacagataaaccatctgattcctctgttctatttttcgctaaagactcattcttg  3616000
                                                                                         --------->ATERF1(1)
                                                                                         <------NtERF2
                                                                                        <---------ATERF1(1)
                                                                                       ----------->HVH21
                                                                                       --------->DEAR3(1)
                                                                                      --------->RAP2.3(1)
                                                                                     --------->LBD16
                                                                                  -------->P
                                                                                  --------->MYB52(1)
                                                                              ------>MYB46(1)
                                                                            <---------MYB59
                                                                           --------->DEAR3(2)
                                                                        --------->ARR11(2)
                                                   ------>ZmHOX2a(2)   <-------GAMYB--------->ATERF1(2)
                                                 --------->RVE1(2)     --------->At5g28300     -----
                                                 <---------GATA12 ----------->HVH21 <---------ATERF1(2)
         <---------YAB1                          <---------ARR11(3)------------>AtMYB77<---------DEAR3(1)
       <---------KAN1                            --------->ARR11(3)--------->MYB52(1)--------->ANAC46
      --------->GLK1(2)                      --------->YAB1--------->DOF5.7(1)------>MYB83  --------
 ---------->DOF2       <---------ICU4       --------->DOF5.7(1)  <---------WOX13(1)--------->DEAR3(2)
------>ID1            --------->ICU4      ---------->DOF2---------->DOF2<---------ARR11(2)<---------DEAR3(1)
------>ARF1      --------->RVE1(2)    <----------ID1 ---------->DOF2  <---------MYB46(3)------>NtERF2
 
tctcaaaagaatatgatcaagagccaaaattacagagcaatacaacaaagatgatctaaagaaagaagattgacggttaccgacttaccggcgacggtga  3616100
                                                                                                   -
                                                                                                  --
                                                                                                  <-
                                                                                                 ---
                                                                                                 <--
                                                                                                 ---
                                                                                                 <--
                                                                                                 <--
                                                                                                 ---
                                                                                                 <--
                                                                                                <---
                                                                                                ----
                                                                                               <----
                                                                                              ------
                                                                                              <-----
                                                                                             -------
                                                                                             <------
                                                                                             <------
                 <---------------------WRI1                                                  -------
               <---------ETT(2)                                                           --------->ALFIN1
        <------ZmHOX2a(2)                                                                ------->MYC3
        <---------KAN1                                                                  <---------ANAC58
       <---------ARR11(2)     --------->DOF5.7(1)                 --------->WOX13(2)    ------------
       --------->ARR11(2) --------->ANAC58               <<<<<<<<<MYB2                  <---------ANAC46
       --------->RVE1(2)  --------->ANAC46             <------MYB83                     <---------ANAC58
  --------->MYB52(1)      --------->ANAC58             <------MYB46(1)             <---------KAN1<--
  --------->DOF5.7(1)  --------->ARR14(2)             *TSS        <---------WOX13(2)    >>>>>>>>CAMTA3
 --------->DOF5.7(1)   <---------ARR14(2)             <---------AtMYB61   ==========================
------>GT1     --------->ETT(2)     <---------TOE2(2) --------->MYB59     <----------DOF2<-------MYC3
->At5g28300   --------->DDF1---------->DOF2     --------->DOF5.7(1)      <---------DOF5.7(1)<-------
 
gtaaaaaacggatcaatgtcgacgaagacccgaaagacggaggtttttccaaagggtttggttttcttcaatttggcctttgccgaataacgcgtgggcc  3616200
-------->ALFIN1
----->MYC3
------MYC3
------>O2
-------TGA1a
------>TGA1a                                                                            <---------ARR14(2)
-------ANAC58                                                  --------->GATA12         <---------ARR11(2)
-------O2                                                      --------->RVE1(2)        --------->ARR14(2)
------>ALFIN1                                                  <---------GATA12         <---------RVE1(2)
-------ANAC58                <---------WOX13(2)                <---------ARR14(2)       --------->ARR11(2)
---NtERF2                    --------->WOX13(2)                --------->ARR14(2)    ------>ZmHOX2a(2)
-->NtERF2               <---------At4g35610                   --------->KAN1       <---------RVE1(2)
-----ANAC46             --------->At4g35610              ----------->GT1     <------MYB46(1)      <-
--->ATERF1(1)         <---------WRKY45                  ----------->GT1<---------AHL12(3)         <-
----DEAR3(1)          <---------WRKY38(1)           --------->MYB52(1) --------->AHL25(3)        ---
-->ATERF1(1)          <---------WRKY12           <---------AHL12(2)    <---------AHL25(1)        ---
----------PIF3(2)    <<<<<<<<<<WRKY11            <---------WOX13(2)    <---------AHL20(2)        ---
---PCF2              <<<<<<<<<<WRKY6   <------MYB83 <-----------GT1    --------->AHL25(1)        <--
-->PCF5              --------->WRKY18(1)         --------->WOX13(2)   --------->AHL20(2)<---------GLK1(2)
-->OsCBT            <-----------HVH21  ----------->GT1  --------->LBD16--------->AHL12(3)        <--
-------ANAC46       <--------ZAP1      <------MYB46(1)<---------LBD16 --------->AHL25(3)--------->GATA12
=======bZIP_DOF --------->MYB52(1)    --------->MYB59<---------At5g28300     <------MYB83      <----
--PCF5      ------>NtERF2 ------------>CBF  <-----------GT1  ----------->ARR10<<<<<<<<<<MYB80  -----
 
gcgtggctctctctctgcccatcggtcaactcaattttggttcggtttaacaaattaaccgggtaaaatccgatataatttggtttgatcggattctcaa  3616300
    --------->LBD16
   <---------ANAC58
   <---------ANAC46
   <---------ANAC58
  <---------LBD16
--------AHL25(3)             <---------At4g35610
--------AHL20(2)             --------->At4g35610                        ------>MYB83             <--
------>AHL25(1)              <---------ZAT2    <---------ZAT2           ------>MYB46(1)       <-----
------>AHL20(2)              --------->ZAT2    --------->At4g35610      --------->MYB52(1) ---------
------>AHL25(3)     --------->YAB1             --------->ZAT2      <<<<<<<<<GT-1          <---------
-------AHL25(1)    <---------ATHB12            <---------At4g35610 <-----------GT1     <---------DOF5.7(1)
-------AHL20(2)    <---------ATHB51      <-----------HVH21      --------->WOX13(2)    <---------MYB52(1)
-----WOX13(2)     --------->WOX13(2)   --------->LBD16        <---------YAB1     <---------RVE1(2)
---->WOX13(2)     <---------WOX13(2)  <---------LBD16         --------->ICU4   <---------YAB1<------
 
ttaaatgcgggtttaaaattcaattatgttccagctctcttcccggtctgagcaggctcaagaacattattaaccaaacgttttgattcgttttttcttt  3616400
                                                  --------->YAB5
                                               --------->YAB5
                                             <---------TOE2(3)
                                         --------->WOX13(2)
                                       --------->AHL25(1)
                                       <---------AHL25(1)
                                       <---------AHL25(3)
                                       --------->AHL25(2)
                                       <---------AHL12(3)
                                       <---------AHL25(2)
                                       <---------AHL20(2)
                                       --------->AHL12(3)                             <---------At4g35610
                                      <---------AHL25(1)                        --------->WOX13(2)
                                      <---------AHL25(3)                        <---------WOX13(2)
                                      <---------AHL20(2)                      <---------------AGL15
                                      --------->AHL20(2)                      --------------->AGL15
                                      <---------AHL20(1)                     ----------------->AGL3
                                      --------->AHL20(1)                     ----------------->AGL2
                                      --------->AHL12(3)                   <-----------GT1
    <----------DOF2                   --------->AHL25(3)                <---------AHL20(2)
<----------DOF2                       <---------AHL25(2)                <---------AHL25(1)
---------GT1                          <---------AHL12(3)                <---------AHL20(3)        <-
----DOF5.7(1)          <-----------GT1--------->AHL25(2)                --------->AHL12(3)    <-----
->ID1   <---------ANAC46              --------->AHL25(1)                --------->AHL20(3)  <-------
--GT1   <---------ANAC58         --------->AHL20(2)                  ------->TEIL  <---------At5g28300
----DOF2<---------ANAC58      --------->YAB1<-----------GT1    <---------YAB1----------------->AG<<<
 
tttctttctttgtgtgtgtttagcattaaccaattttaaaataaaatttacgatgacaaaaatgttatgatgtatttttttccaattacagctattttat  3616500
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              <-----
                                                                                             -------
                                                                                             <------
                                                                                             -------
                                                                                             -------
                                                                                             <------
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                                                       <-----------GT1
                                                                                  <---------AHL12(1)
                                                                                  <---------AHL12(3)
                                                                                  --------->AHL25(1)
                                                                                  --------->AHL12(3)
                                                                                  <---------AHL20(2)
                                                                                  --------->AHL12(1)
                                                                                 <---------AHL12(1)
                                                                                 --------->AHL12(1)
                                                                                 --------->AHL25(2)
                                                                                 <---------AHL20(2)
                                                                                 --------->AHL20(2)
                                                                                 <---------AHL25(3)
                                                                                 --------->AHL20(1)
                                                                                 --------->ARR11(3)
                                                           --------->At4g35610   <---------ARR11(3)
                                                          <-----------RAV1(1)    <---------AHL20(1)
                                                        --------->KAN1           --------->AHL20(3)
                                                      <---------AHL12(3)         --------->AHL25(3)
                                                      <---------AHL12(2)         <---------AHL25(2)
                                                    --------->AHL20(2)           <---------AHL25(1)
                                                    <---------AHL12(3)           <---------AHL20(3)
                                                    --------->AHL12(3)           --------->AHL25(1)
                                                    --------->AHL25(1)          --------->AHL12(2)
----------GT1                                       <---------AHL20(3)          --------->AHL12(3)
----TOE2(3)                                         --------->AHL20(3)          <---------AHL12(3)
--AHL20(2)                 <-----------GT1  --------->AHL20(2)------>NtERF2     --------->AHL25(1)
<<<<<<MYB98        ----------->GT1  ---------->DOF2 --------->AHL25(2)<---------MYB52(1)     -------
 
gttactaaacaaatttgttaagttgtaaacttactcttcaaaagcattaaaaaaaaaaaatatgctgccttcagttagtagaaatatatttaacaatttt  3616600
----AHL12(3)
--->AHL25(2)
----AHL20(2)
--->AHL12(3)
----AHL25(2)
--->AHL25(1)
----AHL25(1)
----AHL25(3)
-->AHL20(2)                                                                                 --------
---AHL25(2)                                                                             --------->AHL12(1)
-->AHL25(3)               <---------WOX13(2)                                            <---------AHL12(1)
-->AHL25(1)             <---------YAB1                                                 --------->AHL12(3)
---AHL20(2)           --------->YAB5                                                   <---------AHL12(2)
-->AHL25(2)          <---------YAB1                                                    <---------AHL25(1)
---AHL20(1)        --------->YAB1                                          ----------->GT1--------->RVE1(2)
---AHL12(1)     --------->YAB1                                       --------->DAG2    --------->AHL20(2)
-->AHL12(1)   <---------TOE2(3)              ----------->GT1        ---------->DOF2    --------->AHL25(2)
 
tttttttttgtatatttaagaatgatgtttattgaaattgtttttcatatgtaaaactcaaatgtaaatgcaaaagtgaagtttaaaaaaaaaaatcaaa  3616700
<- Previous    Next ->

AGI:  At1g10865.1   
Description:  similar to predicted protein [Physcomitrella patens subsp. patens] (GB:EDQ61621.1)
Range:  from: 3614539    to: 3616155    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g10870.1   
Description:  AGD4 (ARF-GAP DOMAIN 4); ARF GTPase activator/ protein binding / zinc ion binding. similar to ARF GTPase-activating domain-containing protein [Arabidopsis thaliana] (TAIR:AT1G60860.1); similar to predicted protein [Physcomitrella patens subsp. patens] (GB:EDQ60682.1); similar to hypothetical protein OsI_008027 [Oryza sativa (indica cultivar-group)] (GB:EAY86794.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO15408.1); contains InterPro domain BAR; (InterPro:IPR004148); contains InterPro domain Pleckstrin-like (InterPro:IPR001849); contains InterPro domain Pleckstrin homology-type (InterPro:IPR011993); contains InterPro domain A
Range:  from: 3616610    to: 3623758    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version