AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                              ------>ZmHOX2a(2)
                  --------->ANAC58                           <------ZmHOX2a(2)
                  --------->ANAC58                           --------->CCA1(2)
              <-----------GT1                               <---------ARR14(2)
            <---------AHL25(1)                              <---------ARR11(2)
            --------->AHL20(2)                              --------->ARR11(2)
            --------->AHL25(1)                              <---------RVE1(2)
            <---------AHL20(2)                              --------->ARR14(2)
          <---------AHL12(2)                                --------->AGP1
          <---------WOX13(2)                                --------->GATA12
          --------->WOX13(2)                                <---------GATA12
        <---------AHL20(2)                                  <---------AGP1
        <---------AHL12(1)                                  --------->RVE1(2)
        --------->AHL20(2)                                  <---------ARR11(3)
        --------->AHL12(1)                                  --------->ARR11(3)
        --------->AHL25(3)                                 <---------CCA1(2)                 <------
        <---------AHL25(1)                     --------->ANAC55(2)                          <-------
        --------->AHL25(1)                     --------->ANAC46                             <-------
 ----------->RAV1(1)                         <-----------GT1<-----------ARR10               --------
--------->MYB46(3)--------->ANAC46 --------->KAN1 --------->MYB52(1)                  <-----------GT1
 
acaacaacagattaattaaacaagacatccacaattcgaaattcgatttcacataacgaatcagatctgagtcttcacattcaacattttcacattaacg  2576300
                               ------>ZmHOX2a(2)
                               ==========================HOX2a_HOX2a
                              <------ZmHOX2a(2)
                              --------->CCA1(2)
                              ===========================HOX2a_HOX2a
                             <---------GATA12
                             <-----------ARR10
                             <---------ARR11(2)
                             --------->ARR14(2)
                             --------->RVE1(2)
                             <---------RVE1(2)                                                  ----
                             <---------AGP1                                                    -----
                             --------->AGP1                                                   <-----
                             <---------ARR11(3)                   <---------YAB1             -------
                             --------->GATA12                   --------->YAB1               <------
                             --------->ARR11(3)                 --------->YAB5               <------
                             <---------ARR14(3)                 --------->KAN1               <------
                             --------->ARR11(2)                <---------YAB5                -------
---TOE2(3)                   <---------ARR14(2)              --------->YAB1            ------->TEIL
----GT1                      --------->ARR14(3)           <---------HSFB2a(2) <---------ARR11(2)<---
--DOF5.7(2)             --------->MYB52(1)                --------->HSFB2a(2) <---------RVE1(2)-----
->MYB52(1)--------->MYB52(1)<---------CCA1(2)     ------>ZmHOX2a(1)     <---------TOE2(3)    -------
 
atttactaagaagaaacgaagaacaaataccagatctgccatcttgatcagtccttcaagtctagaatcatgcttaatgttgatacgatgaaactggatc  2576400
  ------>MYB46(1)
  ------>MYB83
--------->MYB46(3)                      ------>ZmHOX2a(2)
--------->AtMYB61                     <---------GATA12
------->HVH21                         <---------ARR11(3)
---->DEAR3(2)                         --------->ARR11(3)
-ZmHOX2a(2)                           <---------RVE1(2)
-->GATA12                          <----------DOF2
---ARR11(2)                       <---------ANAC58       ---------->DOF2                      <-----
---GATA12                         <---------ANAC58   <---------YAB5                   --------->LBD16
---ARR14(2)                    ------->PIF5  --------->ATHB12                 <------ZmHOX2a(1)
-->ARR11(2)                    <-------PIF5  <---------ICU4         ------->TEIL      <-----------HVH21
------ETT(1)              --------->ANAC58   --------->YAB1        <---------ARR11(3)--------->ANAC46
->ZmHOX2a(2)              --------->ANAC46  <---------YAB1       --------->ANAC58--------->ATERF1(1)
-->ARR14(2)               --------->ANAC58  <---------YAB5       --------->ANAC58<---------KAN1
 
cgaccagcccattgaacggtatcaggctcaagcaagtgcttgatcttatcattgtaaacatcaagcgcaagaaccttgtgaggagtctccgtcataagct  2576500
                                                                                          ------>NtERF2
                                                                                         --------->ARR14(2)
                                                                                         --------->ARR11(2)
                                                                                    --------->MYB52(1)
                                                                                    --------->ARR11(2)
                                                                            <------ZmHOX2a(2)
                                                                           <---------ARR11(2)
                                      --------->AtLEC2                     --------->GATA12
                                --------->DEAR3(1)                         --------->ARR11(2)
                               <------NtERF2                               <---------ARR14(2)
                              ------>NtERF2--------->ARR14(2)              <---------ARR11(3)
                             <---------ALFIN1     <---------At4g35610      --------->ARR14(2)   ----
                             --------->DEAR3(1)<---------YAB5              --------->RVE1(2)   -----
                           <---------ATERF1(1)<-----------HVH21            <---------GATA12   <-----
                           ------>NtERF2   --------->ARR11(2)        <---------SPL7(1)   <---------ARR14(2)
                           <-----------HVH21  <-----------TGA1    <---------At5g28300   --------->At4g35610
                           --------->LBD16 <---------ARR11(2)    <-----------GT1 <---------ATHB12
                          --------->ANAC46 <---------ARR14(2)  <----------DOF2  --------->GATA12----
                 <---------ATHB12  <---------ATHB12     --------->KAN1  --------->HSFB2a(2)  <------
     --------->CCA1(2)   <---------LBD16  <---------CCA1(2)<---------YAB5  --------->AGP1<---------ARR11(2)
----GLK1(2)     <---------WOX13(2) <------ZmHOX2a(2)   <----------DOF2  <---------HSFB2a(2)<------NtERF2
 
tctcacagagatgagagccaatgaaacctccggcaccgatcatgcatatcgtcatcggcttaatcggtttaccgtccagatccaatctatcggctccgtt  2576600
                              <---------ARR11(3)
                              --------->ARR11(3)
                           ----------------------->TaNAC69(2)
                        --------->ANAC46
                        --------->ANAC58
                   --------->ZAT14
                <---------DEAR3(2)
               <---------ANAC46
               <---------DEAR4(1)
        <---------RVE1(2) --------->ANAC55(2)
        >>>>>>>>>ARR2 --------->KAN1
       --------->ATHB12 --------->ANAC58
      <---------YAB1 <---------REM1(2)
----->ANAC58   <---------DREB2C(2)      --------->ANAC58                  <---------RVE1(2)
---->SPL7(1)   <---------At1g77200      --------->ANAC58        --------->ALFIN1
----MYB52(1)   --------->ETT(1)         --------->ANAC46      <---------ANAC46                  ----
----->ANAC58   <---------DEAR3(1)    ----------->HVH21       <---------MYB46(3)             --------
---SPL7(1)  <-----------RAV1(1) ------>ZmHOX2a(2)      <<<<<<<<<<<<<<<<<LFY              <----------ARF1
 
cgccatattttgattgtgtcggtgaacacgcgtgatctctctcacgcttctacagagataacaatgggtggaagagagatttgtgagaatgggagaaaag  2576700
                                                                                         <---------TOE2(3)
                                                                                       --------->AHL25(3)
                                                                                       <---------AHL20(2)
                                                                                       <---------AHL25(1)
                                                                                       <---------AHL25(3)
                                                                                       --------->AHL25(1)
                                                                                     --------->WOX13(2)
                                                                                     <---------WOX13(2)
                                                                                <-------MYC2
                                                                                ------->MYC2
                                  --------->AHL20(3)                            ------->PIF5
                                  <---------AHL25(2)                            <-------PIF5
                            <---------ANAC58                                    <-------MYC3
                            <---------ANAC46                                    ------->MYC3
                            ----------->GT1                                    --------->O2
                       ---------->DOF2        <---------ZAT14                  <---------O2
                    <-----------TBP <---------ICU4                             --------->TGA1a
                  <---------CCA1(1) --------->YAB1                             --------->ANAC46
                  <---------RVE1(1)--------->ICU4                              <---------ANAC55(2)
            --------->CCA1(2)     <---------AHL20(3)                           <---------TGA1a
     --------->CCA1(2)<---------AHL20(2)      <---------REM1(2)           <---------ALFIN1
---------->DOF2  <---------RVE1(2)<---------AHL20(2)----------------------->TaNAC69(2)<---------AHL20(3)
------>DOF2<---------RVE1(2)<---------ANAC58  --------->ZAT14--------->AtLEC2<---------ALFIN1
-->DOF2   *TSS ----------->GT1   --------->YAB1<---------ALFIN1           --------->ANAC46        <-
 
aaagaaagaaatgagagatggatatttaaaggcgtataataatgttccctacactctcacagccttgcacattactcccaccacgtgaaattaatgtttt  2576800
                                       <---------At4g35610
                                       --------->At4g35610
                                   --------->ARR14(2)
                                   <---------ARR11(2)
                                   ------->TEIL
                                   --------->ARR11(2)
                                   --------->GATA12
                                   <---------ARR14(2)
                                <---------YAB1
                              --------->YAB1
                             <---------YAB1
                            --------->AHL25(2)
                            <---------AHL20(3)
         --------->ARR14(2) <---------AHL25(2)
         <---------ARR14(2) <---------AHL12(2)
         <---------GLK1(2)  --------->AHL20(3)
        --------->KAN1     <--------HAHB4
    <-----------HVH21      <---------ICU4                --------->GATA12
 <---------ANAC46          -------->ATHB1           ------->MYC3
 --------->ANAC55(2)       --------->ATHB51         <-------MYC3
 --------->TGA1a           --------->YAB5          <---------ANAC55(2)
 <---------ANAC58          --------->YAB1          <---------O2
 <---------ANAC58         --------->ICU4 <---------YAB1 --------->GLK1(1)
 <---------bZIP60(2)      <---------ATHB51         --------->ANAC46
 --------->O2             <---------ATHB12         <---------TGA1a
 <---------O2            <---------WOX13(2)        --------->TGA1a
 <---------ANAC55(1)     --------->WOX13(2)        --------->ANAC55(2)
 <---------TGA1a         --------->AHL12(2)        <---------ANAC46                         <xxxxxxx
 <---------ANAC55(2)    --------->WOX13(1)  <---------WOX13(1)      --------->ZAT6    <---------ZAT14
--------MYB52(1)<---------DOF5.7(1)<---------GATA12--------->O2 <---------AHL20(2)    --------->ZAT14
 
cgttacgtgtcatattctctcttaagtcaattattatgaatctgctgattgttcacgtgaaatctattttaaaactagtagattacaactacagtatata  2576900
                     <---------MYB46(3)
                     <-----------RAV1(1)
                     --------->MYB52(2)
                 <---------YAB1
             <---------ANAC58
             <---------ANAC58
     --------->AHL12(3)
     <---------AHL20(2)
     <---------AHL25(3)
     <---------AHL25(2)
     --------->AHL25(2)
     --------->AHL25(1)                                                 <---------ZAT6
     <---------AHL25(1)                --------->AtLEC2          <------NtERF2             ---------
     <---------AHL12(3)            <---------DDF1               --------->ABI4(2)        <---------WOX13(2)
    --------->AHL25(1)            --------->At1g77200           ------>NtERF2           --------->YAB5
    --------->AHL20(2)            --------->DEAR4(1)          <-------GAMYB   <---------RVE1(2)
    <---------AHL20(2)            --------->DEAR3(1)          --------->ATERF1(1)      <-------TEIL
    --------->AHL25(3)            --------->DREB2C(2)        <---------DEAR3(2)       <--------P
    --------->AHL25(2)           --------->DEAR3(2)          <---------MYB46(3)     ----------->GT1
    <---------AHL25(2)     <----------DOF2                  <---------At1g77200     <---------MYB46(3)
    <---------AHL20(1)    <---------ANAC58                  <---------DREB2C(2)--------->CCA1(2)
    --------->AHL12(1) ---------->ID1  ----------->GT1      <---------DEAR3(1)<---------ARR11(2)
    <---------AHL12(1)<-------GAMYB----------->RAV1(1)    <-----------HVH21<--------P<-------GAMYB
xxxxxxxxxxxxxsmallRNA(si3)<---------ANAC58           --------->KAN1<----------DOF2<------ZmHOX2a(1)
 
gtttcaatttttttttgggtatgtttgttgctttacaccgacatgtaaaattgtgctaattcgtcggtggccttagtggtagataggaggttgattaaac  2577000
                                                  <---------WOX13(2)
                                                  --------->WOX13(2)
                                                 <---------AHL12(2)
                                                <---------AHL25(3)
                                                <---------AHL20(3)
                                                --------->AHL20(3)
                                                <---------AHL25(1)
                                                --------->AHL25(1)
                                                <---------AHL25(2)
                                                --------->AHL25(2)
                                                <---------AHL20(2)
                                                --------->AHL20(2)
                         --------->ANAC58      --------->AHL25(1)
                         --------->ANAC58      --------->AHL25(3)
                     <------MYB83              --------->AHL20(2)
                     <------MYB46(1)           <---------AHL20(2)
                     ----------->GT1           <---------AHL25(1)
                    <---------MYB46(3)      --------->YAB5
                    --------->MYB55(2)     <---------YAB1
                 <---------ANAC58        <---------ZAT6                             --------->ATHB51
                 <---------ANAC46 <---------AHL12(3)                                <---------ICU4
                 <------MYB83     <---------AHL20(2)                               --------->ICU4
                 --------->ALFIN1 --------->AHL12(1)                               <---------YAB1
                 <---------ANAC58 --------->AHL20(2)                             <---------------AGL15
                 <------MYB46(1)  --------->AHL20(3)                             --------------->AGL15
                <---------MYB46(3)<---------AHL12(1)                             --------->TOE1(3)
                --------->MYB111(2) <---------WOX13(2)                           --------->YAB1
                <---------DEAR3(1)--------->AHL20(1)                             --------->TOE2(3)
                --------->MYB55(2)--------->AHL25(3)                            <---------ATHB12
                --------->MYB111(1) --------->WOX13(2)    --------->AHL25(1)    <-----------------AGL2
               <---------MYB55(1) --------->AHL25(1)      <---------AHL20(3)    <-----------------AGL3
               --------->ALFIN1   <---------AHL25(3)      --------->YAB1        --------->MYB46(3)
               <---------ANAC46   <---------AHL25(2)      --------->AHL20(3)    ----------------->AGL3
             <---------MYB46(3)   <---------AHL25(1)      --------->AHL20(2)   ------>MYB83  <------
            --------->ALFIN1      --------->AHL25(2)   --------->YAB1          -------->P    <------
        <---------ZAT14<--------P--------->AHL25(3) <-----------GT1            ------>MYB46(1)
 --------->CCA1(2) --------->ALFIN1<---------AHL25(3) <---------YAB1   ---------->DOF2       <------
>AHL20(2)   <---------AtMYB61 --------->ICU4----------->GT1      --------->At4g35610--------->ATHB12
 
agagaaacgagagaagtggtgggtgggtaagtaagaattaattagtgtgattaaattacaataatataagcttacaaagtccaaccataattggtggagt  2577100
                              --------->DOF5.7(1)
                              --------->DAG2                                                  <-----
                             --------->DOF5.7(1)                                              <-----
                             --------->DAG2                  ----------->GT1                 <------
                            --------->DOF5.7(1)              --------->ANAC58            --------->SPL7(1)
                            ---------->DOF2                  --------->ANAC58           <---------ARR14(2)
                       --------->ANAC58                      --------->ANAC55(1)        --------->ARR14(2)
                       --------->ANAC58     --------->YAB5   --------->ANAC46  <-----------GT1<-----
    ---------->DOF2--------->CCA1(2)   --------->ANAC58      <---------ANAC55(2)        --------->ARR11(2)
---ANAC58       --------->ANAC58       --------->ANAC58      --------->ANAC55(2)        <---------ARR11(2)
---ANAC46       --------->ANAC46  --------->ZAT18     <---------REM1(1)      <---------AHL20(2)
---ANAC58       --------->ANAC58 --------->ALFIN1     ----------->GT1       --------->YAB1--------->MYB46(3)
 
gaatgctaaaagctactacaagaaacgagcaaaaaggtggacaaggaagactactagttgtaacaagtaataacttctattaaaactctccgaaccgctt  2577200
<- Previous    Next ->

AGI:  At1g08200.1   
Description:  AXS2 (UDP-D-APIOSE/UDP-D-XYLOSE SYNTHASE 2). similar to AXS1 (UDP-D-APIOSE/UDP-D-XYLOSE SYNTHASE 1) [Arabidopsis thaliana] (TAIR:AT2G27860.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO43127.1); similar to unknown [Populus trichocarpa] (GB:ABK94776.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO16707.1); contains InterPro domain NAD-dependent epimerase/dehydratase; (InterPro:IPR001509); contains InterPro domain NAD(P)-binding; (InterPro:IPR016040)
Range:  from: 2573845    to: 2576711    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g08210.1   
Description:  aspartyl protease family protein. similar to aspartyl protease family protein [Arabidopsis thaliana] (TAIR:AT5G22850.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO62959.1); contains InterPro domain Peptidase aspartic, catalytic; (InterPro:IPR009007); contains InterPro domain Peptidase A1; (InterPro:IPR001461)
Range:  from: 2577017    to: 2580666    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version