AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                    --------->AHL12(2)                             --------->ZAT14
                     --------->At4g35610 <---------ZAT18                   <---------WOX13(1)
                  ---------->DOF2   <---------AHL20(3)                   --------->YAB5
               ---------->DOF2<---------HSFB2a(2)                        --------->ATHB12
              ------->GAMYB   --------->HSFB2a(2)                       <---------YAB1
             --------->MYB46(3)     <---------AHL12(2)                  --------->ICU4
             <---------MYB55(2)--------->LBD16                        --------->YAB1
            -------->P --------->RAP2.6(2)            <---------YAB1  --------->YAB5
            ------>MYB46(1) --------->AtLEC2 <----------DOF2         --------->ICU4<---------ZAT14
            ------>MYB83 --------->MYB46(3)------->TEIL   --------->KAN1<---------YAB5 <---------YAB1
gaatcaaacaattccaaccaaagaagcagccatccagaaaattatgcactttctaataccattgttcgtgaaatgatgattggcagtgttcttattcact  13266600
                                                                  --------->ZAT2        --------->ATHB12
                                                                  <---------At4g35610   <---------ICU4
                                                                  --------->At4g35610   -------->HAHB4
                                                        <---------GATA12 --------->ARR11(2)
                                          ----------->GT1     <---------ATHB12   --------->ANAC46---
   --------->AtMYB61                      <----------ID1--------->ARR14(2)--------->HSFB2a(1)    ---
<----------ID1           --------->YAB5--------->DOF5.7(1)<-------TEIL<---------TOE2(3) --------->YAB5
aaaacaccaaaacgcttcttaacaaaaaccattaacaagagaaaaacgaaaaactgccagattcaatcgagctgaggatattccacataaatgatggcaa  13266700
                                    --------->GATA12                                   <---------TOE2(3)
                                    <---------GATA12                                   <---------TOE1(3)
---------->DOF2              <---------GATA12              <-----------GT1         <-----------HVH21
------>TOE1(3)               --------->GATA12            --------->RVE1(2)      <---------KAN1   ---
------>TOE2(3)          <-----------HVH21               --------->YAB1    --------->CCA1(2)  -------
ccttaaaaccagaagttttagtaactgggtcacatcttaaatctgaatttgaaaaacaaaaatcaccctcgaagaagagacggacatgtcaaggtatcaa  13266800
              --------->ZAT14           <---------GLK1(1)
              <---------ZAT14           --------->GLK1(1)
              --------->ZAT18          --------->GATA12
            --------->ANAC46        <------ZmHOX2a(1)
       --------->ZAT14           <-----------RAV1(2)
       --------->ZAT18         ------>MYB83
       <---------ZAT14         -------->P    <-----------RAV1(2)                   >>>>>>>>>TBF1
    ---------->DOF2            ------>MYB46(1)                                  >>>>>>>>>TBF1
 <---------WOX13(2)           --------->ORA47(1) --------->ARR14(2)          >>>>>>>>>TBF1--------->DOF5.7(1)
---->GAMYB  --------->ANAC58 --------->DEAR3(1)--------->ANAC58        <------ZmHOX2a(1)---------->DOF2
-->MYB46(3) --------->ANAC58--------->DEAR3(2) --------->ANAC58      ------------------------>ANAC81
ccgaaattagagcacagggcactgtctcaaaaccgaccaggagatttctcaggctacgcttaatacaaatagaaggagaagaagaagaagaaaaagatga  13266900
                             --------->RVE1(2)           ------>NtERF2
                             <---------ARR11(3)          --------->At5g28300                   <----
                             --------->GLK1(2)         --------->ATERF1(1)                 <--------
                             <---------ARR14(2)        <------NtERF2                --------->ARR14(2)
                             <-----------ARR10         <---------DEAR3(1)           <---------ARR14(2)
                             <---------ARR11(2)       <---------LBD16               ------->TEIL
                --------->WOX13(2)                    ------>NtERF2                 --------->GATA12
                <---------WOX13(2)  ----------->HVH21<---------ANAC58              <---------GLK1(2)
   <---------HSFB2a(2)       --------->ARR11(3)      <---------ANAC58          --------->WOX13(2)
  <---------LBD16            --------->ARR14(2)      --------->ALFIN1          <---------WOX13(2)
 <---------ANAC46           <---------KAN1<----------ID1<---------ATERF1(1)    --------->At4g35610
 ----------->RAV1(2)<---------TOE2(3)    <------ZmHOX2a(1)  --------->KAN1*TSS--------->MYB52(1)
gattacctggaagttttcaaattgacgaagagtatctctgtgaaggagacgaagaggcgcggcgaattcgatagcaagggttaactgaatcttcgtttgt  13267000
                                               <---------TOE2(3)       <-----------GT1
                                          --------->YAB5     --------->YAB5
                                       --------->YAB1       <---------KAN1
                                  <---------YAB1          <---------ICU4
        --------->LBD16           ------------>CBF        --------->YAB1
      <---------LBD16 >>>>>>>>>MYB2    <-----------GT1  --------->ANAC46                           -
     --------->MYB52(1) --------->AtMYB61<---------YAB5 --------->ANAC58                       -----
-----ZAT6      <------------CBF  --------->RVE1(2)      --------->ANAC58                       -----
-MYB52(1)   <-----------TBP   --------->TOE2(3)<---------TOE1(3)     <---------MYB52(2) ----------->GT1
gttaaaacttccggtttatattgaaaaccaaaacattatcaataaccattcaggtttacaagcatgactccaaataaccaggttttttggtttgtgaatc  13267100
                       ------>MYB83                                 <---------RVE1(2)
                     <---------MYB59                      <---------ARR11(3)
                    --------->ANAC46                 <---------AHL20(2)
                <---------AHL20(2)                   --------->AHL25(1)
             <---------WOX13(2)                      --------->AHL20(2)                          ---
             --------->WOX13(2)                      --------->AHL20(3)                         <---
           --------->AHL25(3)             <-----------RAV1(1)     <---------YAB1             <------
 ------->GAMYB  <---------AHL25(1)     --------->ARR14(2) --------->RVE1(2)             <---------ARR11(3)
-------->At4g35610<-----------GT1      <---------ARR14(2) --------->ARR11(3)          --------->ANAC58
---->YAB1  <---------AHL20(2)         <---------CCA1(2)  <---------CCA1(2)            --------->ANAC58
---->YAB5  --------->AHL25(1)  --------->MYB59       --------->AHL12(3)            <---------ATHB12<
acaactgaaatgttttaatttaaacccaactaattaggcccatatatgtggcccatttatatatctattttgattctgttcatcaaatcaagaaatttac  13267200
         --------->YAB1                             <---------WOX13(2)
       <---------RVE1(2)                            --------->WOX13(2)
      --------->YAB1                              <---------AHL20(2)
--------->YAB1                                    --------->AHL20(2)      <---------DOF5.7(1)
------>YAB1                          <---------ANAC58        --------->ANAC58                      -
------YAB5  --------->YAB1           <---------ANAC58        --------->ANAC58                      -
-----GT1<---------YAB5         ---------->DOF2    --------->AHL25(1)     <---------DAG2            -
---------YAB5       ---------->DOF2 <-------TEIL  <---------AHL25(1)     <----------DOF2    --------
tcatcatattgatcatcaaaattcaaagtcatactaaagttcgtgactcacgtttaattcatacaagtaaatggtacttttttttttttttgtaaacgaa  13267300
                                                      ---------->DOF2                  >>>>>>>>>>WRKY62
                                                  ------->GAMYB                        <---------WRKY18(1)
                                                 <------------AtMYB77                  >>>>>>>>>>WRKY18
                                                 --------->MYB46(3)                    >>>>>>>>>>WRKY40
                                                <---------At5g28300                   --------->WRKY12
         --------->ATHB12                      <---------ARR11(2)                     --------->WRKY45
     --------->DOF5.7(1)                       --------->ARR11(2)                     --------->WRKY38(1)
-------->AtLEC2                                <-----------GT1  <---------GATA12    <----------DOF2
-------->ANAC58                      <-----------GT1 <---------WRKY12          ------->TEIL   ------
-------->ANAC58  --------->ARR14(2) <-----------GT1<-----------HVH21  <---------At4g35610    <------
->ANAC46--------->ICU4 ---------->DOF2  <----------DOF2         --------->GATA12<---------CCA1(2)
gcatgcaaaaaatgatttaagaactgcaaagtactagttttatctttttgtaaccgtcaaagttttggatttaagctccttgcatctctttgaccaataa  13267400
                                     <---------GATA12                            <---------ANAC58
                                     <---------RVE1(2)                           <---------ANAC58
                                     --------->ARR14(3)                       <----------DOF2
                                     <---------ARR14(2)                      <---------ANAC58
                                     --------->ARR11(3)                      <---------ANAC58
     ----------->GT1                 <---------GLK1(2)                  <---------ICU4
---->DOF2                     ----------->RAV1(2)--------->ZAT14        --------->ATHB12       -----
--->AHL20(2)         --------->DOF5.7(1) <---------YAB1                <---------YAB1          <----
---ATHB12          ---------->DOF2   <---------ARR11(3)               <---------GLK1(2)        <----
aacccatactgtatatttgactaaaagagagacccctgaagattttgatcagtgttgtgttctcaagtctatagattattgctttcgagtcttcagtaaa  13267500
<- Previous    Next ->

AGI:  At4g26190.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G36550.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO62455.1); contains InterPro domain NLI interacting factor (InterPro:IPR004274)
Range:  from: 13262245    to: 13266975    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version