AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                      <---------ANAC46
                                                      --------->DEAR3(1)
                                                     <------NtERF2
                                                     --------->ATERF1(1)
                                                    ------>NtERF2
                                                    <---------RAP2.3(1)
                                                    <---------ATERF1(1)
                                                    <---------ERF1
                                                    <---------DEAR4(2)
                                                   <---------DEAR3(1)
                                                   --------->DEAR3(1)
                                                   --------->ATERF1(2)
                                                   <---------RAP2.3(3)
                                                   <---------RAP2.3(2)
                                                   <---------ATERF1(2)
                                                   <---------ANAC46
                                                  --------->RAP2.3(1)
                                                  --------->ATERF1(1)
                                                  ------>NtERF2
                                                  <------NtERF2
                                                 <---------RAP2.3(1)
                                                 <---------ATERF1(1)
                                                <---------DEAR3(1)
                                               <---------LBD16
                                              <---------bZIP60(2)
                                              <---------ANAC46
                                              --------->O2
                                              <---------TGA1a
                                              <---------O2     <---------DEAR3(1)
                                           ----------->HVH21   --------->ETT(1)                   <-
--->ZmHOX2a(2)                             ----------->TGA1 <---------MYB46(3)                   <<<
---->GATA12                               <-----------HVH21--------->ALFIN1                      ---
-----GATA12<---------YAB1                <---------ANAC58  <---------AtMYB61 <---------YAB1     <---
---->ARR14(2)        <------ZmHOX2a(1)   <---------ANAC58<---------ZAT2 --------->HSFC1(2)      ----
-----ARR14(2)  <---------ZAT6       <---------DOF5.7(1) --------->ALFIN1--------->At4g35610     <---
-----RVE1(2) <---------ANAC46      =====================bZIP_DOF <------NtERF2         <------ZmHOX2a(1)
-----ARR11(2)<---------ANAC58      <---------DAG2<---------DEAR4(2)     <---------HSFC1(2)      ----
---->ARR11(2)<---------ANAC58      <----------DOF2<---------ABI4(1)    --------->GLK1(2)       <----
 
tcgggtactgggttttgagtgtgaggagaaagtttaggctttttgggtgacgcggcggcgaggtggtcggagagaagcttacgcttggaaggagagaagg  13048000
           --------->KAN1
          <---------ARR11(3)
          --------->ARR14(2)
          <---------ARR14(2)
         <---------RVE1(1)
         <---------CCA1(2)
         <---------KAN1
         --------->GLK1(1)
         <---------GLK1(1)
        --------->ARR14(2)                           <---------ANAC58
        ----------->ARR10                            <---------ANAC58
        <---------ARR14(2)     --------->ATHB12      --------->MYB52(2)
        --------->ARR11(2)     --------->YAB5--------->ARR14(2)
        <---------ARR11(2)     --------->KAN1<---------ARR14(2)
       <------NtERF2          <---------YAB1 --------->ARR11(2)
      --------->LBD16   --------->ALFIN1     <---------ARR11(2)
     <---------ANAC46  <------NtERF2         <---------GLK1(2)
     <---------ANAC58<---------DEAR3(1)      <---------GATA12
     <---------ANAC58<---------ANAC46      --------->LBD16        <---------KAN1
    <---------LBD16  <---------DREB2C(2) <-----------------AG    --------->GATA12
  --------->ALFIN1  <------NtERF2        <-----------------AGL1  <---------GATA12
------TEIL--------->ARR11(3)  <---------YAB5 --------->GATA12    --------->ARR14(2)
<<<<<<<<<<<<<<LFY   --------->ATERF1(1)  ----------------->AGL1  <---------RVE1(2)
------>CCA1(2)      <---------ABI4(1)    <---------LBD16         <---------ARR11(2)
------ARR11(2)     ------>NtERF2--------->ARR11(1)   <---------ANAC46
----->ARR14(2)    <---------DEAR3(1)    -------->P  <-------TEIL <---------ARR14(2)
------ARR14(2)    ----------->HVH21     --------->MYB52(1)    <------NtERF2                       --
----->ARR11(2)    --------->ALFIN1   <---------At4g35610     <---------LBD16          --------->CCA1(2)
--ZmHOX2a(1)   <---------DEAR3(1)    --------->At4g35610    <---------ANAC46       ----------->ARR10
 
atacagtggcggatatcttcggtggcggtgttgatgattcggctaccggattcggttcgtgagtcggggatttgggtttgggagcgaagaaacgagaaat  13048100
                          <----------DOF2
                          <---------DAG2
                         <---------ANAC58
                         <---------ANAC58
                    <---------ICU4
                   <---------ATHB51                                    <---------MYB46(3)
           <---------ANAC58     --------->YAB1                         <---------ANAC58
           <---------ANAC58 --------->KAN1                             <---------ANAC58     <-------
      <----------DOF2 <---------WOX13(1)                         <---------ANAC58          <-------GAMYB
 --------->At4g35610--------->ATHB12                             <---------ANAC58          <--------
 <---------ZAT2    <---------YAB1                                <---------ANAC46          <--------
 <---------At4g35610--------->ATHB51                            --------->ALFIN1  <---------ANAC58
<-----------RAV1(1)<---------ATHB12                           <------MYB83  <---------RVE1(2)
--------->RAV1(2)  --------->ICU4         ------>ZmHOX2a(1)   <------MYB46(1)     <---------ANAC58
 
cgtctgctgcttttgcttgcccataattgctttattcgtaatctcctccgtttaagagaaatggaaggtcgtggtcgtggctatggcgaacttgggttgc  13048200
                <---------TOE2(2)                                                        --------->ICU4
                <---------TOE2(3)                                           --------->ARR11(2)
                <---------TOE1(2)                                           <---------ARR11(2)    <-
      <---------ZAT18                                                     <---------MYB46(3)      --
      --------->ZAT18                                                  --------->MYB52(1)<---------YAB1
    <---------LBD16     --------->WOX13(1)                   ----------->HVH21        <---------MYB52(1)
   <---------ANAC58   ------------>CBF            --------->ZAT14  --------->ANAC58  --------->At5g28300
-P <---------ANAC58  *TSS                         <---------ZAT14  --------->ANAC58 ----------->GT1
-ANAC58   <----------DOF2--------->RVE1(2)  <-----------HVH21----------->TGA1       <---------MYB46(3)
-ANAC58  <---------DOF5.7(1)         --------->WOX13(1)  ---------->DOF2  <---------DEAR3(2)    <---
 
caattttcgcgcgctttcttaggttgccaatctctctaatccatcactgtcactgaacaacaaagtgacgaagccatcggttcggagcggttattatggg  13048300
                                                                           <------MYB46(1)
                                                                           <------MYB83 <---------AHL12(2)
                                                                          --------->MYB111(1)
                                                                          --------->ALFIN1
                                                                          <---------AtMYB61
                                                                          <---------MYB46(3)
                                                                   --------->HSFB2a(2) --------->KAN1
                                                             <---------ZAT18          <---------AHL20(2)
                                                             --------->ZAT18          <---------AHL25(1)
                                                             --------->ARR14(2)      *TSS
       ----------->TBP                                       --------->ZAT14  <---------MYB46(3)
       <---------YAB1                                        <---------ZAT14 <---------AtMYB61
   <----------DOF2        <---------AHL20(2)                 <---------ARR14(2)   <---------YAB5
  <---------DOF5.7(1)     --------->AHL20(2)                 --------->ARR11(2) <---------bZIP60(1)
-----NtERF2       <---------MYB52(1)              --------->YAB1   <---------HSFB2a(2)--------->AHL20(2)
------->LBD16    ----------->GT1      --------->DAG2         <---------ARR11(2) --------->bZIP60(1)
------LBD16      <---------RAP2.6(3) ---------->DOF2     --------->YAB5   --------->MYB111(2)
 
ccgggtctttataaatgggccggtattttttaaatgggcctaaagtgccactataacaaatgagtatactctagaagttggtggtgtcattaattctccg  13048400
                                    <----------CDC5
                                  --------->DEAR3(1)
                                 --------->MYB46(3)
                                ------>NtERF2
                               <---------ALFIN1
                            <---------TCP20
                            --------->PCF2
                          <---------SPL7(1)
                        --------->SPL7(1)
                      <-----------HVH21
                      <---------SPL7(1)
                      <---------RAP2.6(3)
                      ------>NtERF2--------->At4g35610
                <-------GAMYB --------->MYB46(3)                                <---------GLK1(1)
               --------->ANAC46--------->ANAC46<---------GATA12                --------->ARR11(3)
   ------>ZmHOX2a(2) <---------ANAC58          --------->GATA12                <---------GATA12
  <------ZmHOX2a(2)  <---------ANAC58    <---------ZAT6                        <---------ARR11(3)
 <---------GATA12    <---------ATERF1(2)<---------WOX13(1)          --------->ANAC46
 <---------ARR11(3) --------------->AtSPL3  <---------WOX13(1)    <---------ALFIN1
 --------->GATA12<---------MYB52(1)<---------At4g35610            --------->ANAC46 <-----------GT1
 
tcgagatcgcttctctccccgttgccgtccgtccccaccgctgagtgatagatcgaaacagagaaacacacacggcgaagaagatttcaccatattttgt  13048500
                                                   --------->ARR14(2)
                                                   --------->MYB52(1)
                                                   ------->TEIL
                                                   <---------ARR11(2)
                                                   <---------ARR14(2)
                                                   --------->ARR11(2)
                                                --------->ANAC58
                                                --------->ANAC55(1)
                                                --------->ANAC46
                                                <---------ANAC55(2)
                                                --------->ANAC55(2)                   --------->ANAC58
                                                --------->ANAC58                      --------->ANAC58
         <-------GAMYB                         --------------->AtSPL8            <---------TOE2(3)
     --------->GLK1(2)                         --------------->AtSPL3           --------->MYB52(1)
    <---------ARR11(2)                  ----------->GT1              --------->At4g35610           -
    <---------GLK1(2)                   <---------MYB46(3)           <---------At4g35610          --
    <---------RVE1(2)                <---------At4g35610 <----------DOF2<---------LBD16    <--------
    --------->ARR11(2)               <---------ZAT2-------->P        <---------ZAT2<------ZmHOX2a(1)
    <---------ARR14(2)             <-----------RAV1(2)--------->ANAC46<---------GLK1(2)    ---------
    --------->ARR14(2)--------->CCA1(2)--------->ALFIN1 <---------DOF5.7(1)   <---------MYB52(2) ---
 
ctaagtggattctgttgagagagagagatggctatgtctcaggtggtgaacacgtacccgctttcgaactacagcttcggaactaaggaacccaagctgg  13048600
                ------>NtERF2
                --------->ORA47(1)
                <---------SPL7(1)
               ----------->HVH21
               --------->DEAR3(1)
              --------->DEAR3(2)
              --------->RAP2.3(1)
              --------->ORA47(2)
              --------->ATERF1(1)
              <------NtERF2
             <---------ATERF1(1)
             <---------RAP2.3(1)
             ------>NtERF2
            --------->DEAR3(1)                       <---------DOF5.7(1)
           --------->ATERF1(1)                      ------>ZmHOX2a(1)
          <-----------HVH21                     --------->ARR11(2)
 <------ZmHOX2a(1)   --------->ZAT2           --------->YAB5                                  ------
-------->DOF5.7(1)--------->SPL7(1)          <---------YAB1  <---------DOF5.7(1)<---------------AGL15
------->DOF5.7(1)--------->MYB52(1)     <---------------AtSPL8      <----------DOF2<---------YAB1
-ZAT2     <---------ATERF1(1)           <---------------AtSPL3<----------DOF2   --------------->AGL15
>ZAT2    --------->ANAC46            --------->RVE1(2)<----------DOF2<---------DOF5.7(1)      <-----
------->DOF2<---------DEAR3(1) <---------TOE1(2)--------->ARR14(2) <---------DOF5.7(1)       <------
 
aaaaggacacctccgtcgccgaccggctcgctcgtatgaaaatcaagtacgattcctctttccttctttctcttttttgttttcttcttatagctactgc  13048700
                                                              ------>ZmHOX2a(2)
                                                            --------->ARR11(3)
                                                          <---------YAB5                          <-
                                                        --------->YAB1                            --
                                                        --------->YAB5                   <----------DOF2
                                                      <---------RVE1(2)            --------->ARR14(2)
       <---------ANAC58                               --------->ARR11(3)           --------->ARR11(2)
       <---------ANAC58                               --------->GATA12             <---------ARR14(2)
   --------->At4g35610                       --------->KAN1 <---------ARR11(3)     <---------ARR11(2)
  --------->DOF5.7(1)                      <-----------GT1<---------YAB1           --------->RVE1(2)
--->At4g35610                           <----------DOF2<------ZmHOX2a(2)        <---------ANAC58  <-
----At4g35610                 <---------GATA12        <---------ARR11(3)        <---------ANAC58  --
-----RAV1(1)                 <---------GLK1(1)   --------->TOE2(3)             --------->YAB5    <--
 
tggagaagatgcctgagaattgaaaaccctagaaatctccaggcttttacattcttagatcatgatctcgatgttttctaaatgcttatctgctttctcg  13048800
                                   <---------DOF5.7(1)
                                  <---------YAB5
                                 --------->GLK1(2)
                               <---------KAN4(1)
                               --------->KAN1
                               <---------KAN1
         <-----------GT1       --------->KAN4(1)
      --------->WOX13(2)      <---------KAN4(2)                                           --------->ARR11(3)
 --------->At4g35610    ---------->DOF2                                                   --------->AHL20(1)
 <---------At4g35610  ------>ZmHOX2a(1)                                               <-------TEIL
--------ZAT2         --------->TOE1(3)                      <---------TOE2(3)      <---------MYB46(3)
------->ZAT2   <---------GLK1(2)--------->YAB1              <---------TOE1(3)     <---------------AtSPL8
--------At4g35610    --------->TOE2(3)                  <----------DOF2           --------------->AtSPL8
------->At4g35610  <---------------AGL15          --------->ANAC46                <---------------AtSPL3
---------RAV1(1)   --------------->AGL15        <-----------GT1           --------->REM1(1)
 
ctgctgctgaatttactagcttctccttaaaggaataatcttttggccattttacacaactttaaggtttcaaaactacaacttggtggtacatatattg  13048900
<- Previous    Next ->

AGI:  At4g25540.1   
Description:  MSH3 (ARABIDOPSIS HOMOLOG OF DNA MISMATCH REPAIR PROTEIN MSH3). Identical to DNA mismatch repair protein MSH3 (MSH3) [Arabidopsis Thaliana] (GB:O65607;GB:O81818); similar to MSH6 (MUTS HOMOLOG 6-1) [Arabidopsis thaliana] (TAIR:AT4G02070.1); similar to predicted protein [Physcomitrella patens subsp. patens] (GB:EDQ77304.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO15508.1); similar to H0124B04.17 [Oryza sativa (indica cultivar-group)] (GB:CAJ86300.1); contains InterPro domain DNA mismatch repair protein MutS, C-terminal; (InterPro:IPR000432); contains InterPro domain DNA mismatch repair protein MutS-like, N-terminal; (InterP
Range:  from: 13042566    to: 13048222    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g25550.1   
Description:  protein binding. similar to ATCFIM-25/CFIM-25 (ARABIDOPSIS HOMOLOG OF CFIM-25) [Arabidopsis thaliana] (TAIR:AT4G29820.1); similar to unknown [Populus trichocarpa] (GB:ABK95571.1); contains InterPro domain Cleavage and polyadenylation specificity factor, 25 kDa subunit (InterPro:IPR016706)
Range:  from: 13048386    to: 13051178    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version