AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                    <---------ARR14(2)
                                                                                    --------->RVE1(2)
                                                                         <---------WOX13(1)
                                                                       --------->YAB5
                                                            <---------------AGL15   --------->GATA12
                                                   --------->GLK1(1)   --------->ATHB12
                                                   <---------GLK1(1)  <---------YAB1--------->ARR14(2)
             --------->At5g28300                --------->ANAC58      <---------KAN1<---------GATA12
         ----------->RAV1(1)                    --------->ANAC46    <------ZmHOX2a(1)    ---------->DOF2
      <---------KAN1 ------>ZmHOX2a(1)          --------->ANAC58   XXXXXXXXXXXXXXXXXXXX>MIR864-5P
---------->DOF2     --------->TOE2(3)        --------->TOE1(2)   <---------LBD16----------------->AGL1
------->TOE2(3)--------->KAN1      ----------->HVH21       <-----------------AGL2   --------->GLK1(2)
 
acctaaagaatgccacagtaattcctaaattgttctaagtgacataaacccaagaaatccattctatttcaggatgattgacttccaaatctgaaagaaa  7938200
                                                                                  --------->AHL20(3)
                                                                                 --------->AHL20(2)
                                                                                 --------->AHL25(3)
                                                                             <-------TEIL
                                                                            <------ZmHOX2a(2)
                                                                           <---------ARR14(2)
                                                                           --------->GATA12
                                                                           --------->ARR11(2)
                                                                           <---------ARR11(2)
                                                                           --------->ARR14(2)
                                                      <---------AHL12(2)   --------->AGP1
    ------>MYB46(1)                     --------->MYB52(1)                 <---------GATA12
    ------>MYB83--------->KAN1          ----------->RAV1(1)                <---------ARR11(3)
  <---------MYB46(2)         --------->MYB52(1)--------->AHL20(2)          --------->RVE1(2)
  <---------MYB59<---------GLK1(2)   ------------------------>ANAC81       --------->ARR11(3)-------
 
ttagacctaactcgttgtcaaattcttcgtactaactgaagaacaacagattaaaaaaaaaaacacatttcattctaagatccataaatttctaagaagg  7938300
                    --------->At4g35610
                    --------->ZAT2
                    <---------ZAT2        <---------KAN1
                    <---------At4g35610  <---------ARR14(2)
                  ------>NtERF2          --------->ARR14(2)
                 --------->DEAR3(1)      --------->GLK1(2)
                <----------CDC5          <---------ARR11(1)
               ------>NtERF2             ------->TEIL
               --------->At4g35610      <---------ARR14(1)
               <---------At4g35610   <---------------------WRI1
               <------NtERF2        <---------DOF5.7(2)
             --------->ATERF1(1)   <---------WRKY38(1)
             --------->SPL7(1)     <---------WRKY12
            --------->TCP16(2)    --------->DOF5.7(2)
           <---------TCP16(1)     <------NtERF2
           --------->ARR11(2)    <-----------HVH21
           --------->GATA12      ------>NtERF2
           <---------ARR11(2)   <---------ANAC46
           <---------ARR14(2)  <------NtERF2
           --------->ARR14(2) <---------RAP2.3(1)
           <-----------HVH21  ------>NtERF2
           <---------PCF5    <---------RAP2.3(3)
         <---------MYB46(3)  --------->bZIP60(1)
         <---------DEAR3(2)  <---------RAP2.6(2)     <---------GLK1(1)                      <-------
        <---------ANAC58     <---------bZIP60(1)     --------->At4g35610                  --------->MYB55(2)
        <---------ANAC58     <---------DEAR3(1)      <---------ZAT2                       <---------MYB46(3)
        <---------ANAC46    --------->RAP2.6(3)      --------->ZAT2                 <-----------HVH21
        --------->ETT(1)   --------->MYB52(1)  <---------AtLEC2               <---------ANAC58
      <-----------HVH21   ----------->HVH21 <----------DOF2                   <---------ANAC58  <---
     <-----------RAV1(1)  ----------->TGA1--------->HSFB2a(1)      <---------MYB52(2) <---------WRKY12
-->DOF5.7(1)<---------ATERF1(1)--------->RAP2.3(1)   <---------At4g35610      <---------ANAC46------
 
gacacttactgtcgggtccgccgagctgagtgacggcgtcaacgaatctttcatggagctcagaggtccaacgaaggcgaggcttggggtcagtggttag  7938400
                             <-----------HVH21
                            <---------ANAC46
                            <---------ANAC58
                            <---------ANAC58                                          --------->KAN1
                            <---------ANAC55(2)                                      <-------TEIL
                         <---------ARR11(2)             --------->HSFB2a(2)      ------>NtERF2
                         --------->ARR14(2)             <---------HSFB2a(2)<---------ARR14(2)
                         --------->ARR11(2)    --------->ZAT2              --------->ARR11(2)
                       <------MYB46(1)         <---------At4g35610         --------->ARR14(2)
   --------->KAN1      <------MYB83            --------->At4g35610        <---------GLK1(2)
--ARR11(2)             <---------MYB46(3)      <---------ZAT2<------ZmHOX2a(1)  --------->DEAR3(1)
---ZmHOX2a(1)      --------->ATHB12<---------ZAT14  --------------->AGL15 --------->ARR11(2)      --
--->MYB59         ----------->ARR10--------->ZAT14------>NtERF2         <---------MYB59       <-----
 
gaccagacaagcgtcgatgggaagattggttccgtcagagtagtctcccaagctgccatctagaggaagcgaagaccgaatcgccgagtacattcttctt  7938500
                                                           --------->DAG2
             --------->MYB46(3)                        --------->LBD16                       <------
      ---------->DOF2                                 --------->LBD16                        -------
   --------->ANAC46                         <---------At4g35610 ---------->DOF2             --------
 <-----------------AGL1                  <---------LBD16  ---------->DOF2          <---------ARR11(3)
------>ZmHOX2a(2)              <----------DOF2        <---------LBD16              --------->ARR11(3)
------->GATA12    <----------DOF2<---------AHL20(2)  <---------LBD16               --------->AHL20(1)
-----DOF2 <----------ID1   <---------MYB52(1)       <---------LBD16 ---------->DOF2<---------RVE1(2)
 
tgatccccacaaaggaacaaacttttcttcgtttcttttattttctcggctgttttcccgggaaagtgaaagaaagtgtgaagaaagatattgtggattt  7938600
                                                                                  --------->AHL12(1)
                                                                                  <---------AHL25(1)
                                                                                  <---------AHL20(2)
                                                                                  --------->AHL20(2)
                                                                                  --------->AHL12(3)
                                                                                  <---------AHL12(3)
                                                                                  <---------AHL25(3)
                                                                                  --------->AHL25(1)
                                                                                  <---------AHL12(1)
                                                                                 <---------AHL25(2)
                                                                                 <---------AHL25(3)
                                                                                 <---------AHL20(1)
                                                                                 --------->AHL25(2)
                                                                                 <---------AHL25(1)
                                                                                 --------->AHL20(1)
                                                                                 <---------AHL12(1)
                                                                                 --------->AHL12(1)
                                                                                 --------->AHL20(2)
                                                                                 <---------AHL20(2)
                                                                                 --------->AHL20(3)
                                                                                 --------->AHL25(1)
                                                                          <------------CBF
                                                                         --------->ATHB51
                                                                         --------->ATHB12 <---------CCA1(1)
                                               ----------->GT1           -------->ATHB1   <---------RVE1(1)
                                  *TSS<---------ALFIN1                  <---------YAB1   --------->ARR11(3)
    --------->At4g35610 <---------GATA12     --------->ARR11(2)        <----------DOF2   <---------RVE1(2)
    <---------At4g35610--------->ATHB12      <---------ARR11(2)      --------->ZAT18     <---------ARR11(3)
---GLK1(1)           <---------WOX13(1)      <---------RVE1(2)       <---------ZAT18    <<<<<<<<<RAP2.2
-->GLK1(1) --------->CCA1(2)    --------->ANAC58              <---------YAB1 <---------AHL20(2)
->GATA12----------->ARR10       --------->ANAC58             --------->AHL12(2)  --------->AHL25(3)
 
ctaagacagcgaagaaacgagttgatagattggacaagacaacactcggatagtattttgtgtttatatttgtgcattattgaatttatttagatatttt  7938700
                                                                                                 <--
                                                                                                 <--
                                                                                                 ---
                                                                                                 <--
                                                                                                 ---
                         <---------TOE2(3)                                                      ----
                       --------->AHL25(3)         <---------AtLEC2                              ----
                --------->At4g35610           <----------DOF2                                -------
                <---------At4g35610          <---------DOF5.7(1)                        ----------->GT1
         --------->DOF5.7(1)             <-----------GT1                            --------->DAG2 -
       --------->DOF5.7(1)            --------------->AtSPL8                        --------->DOF5.7(1)
       ---------->DOF2<---------KAN1--------->MYB52(2)  --------->KAN1             ---------->DOF2<-
 
caaaaaaaaaaaaagagagagcagaatttatgttttggttatttgtactctttgcattgaaattccaaataacatatatgttttgaaaaagtagtaagat  7938800
             <---------YAB1
             --------->AHL12(2)
             <---------YAB5
             --------->ICU4
    <----------DOF2
-------AHL12(3)
-------AHL20(2)--------->AHL20(3)
------>AHL12(2)<---------AHL25(2)
-------AHL25(2)<---------AHL20(2)                                                                  <
------>AHL25(1)<---------AHL20(3)                                --------->ALFIN1                  -
----->AHL25(3) --------->AHL25(2)                             --------->DOF5.7(1)    <-----------GT1
----->AHL20(2)--------->AHL12(1)                          --------->YAB1         --------->YAB1  ---
---->GT1  <---------YAB5                                  --------->TOE2(3) ----------->GT1      ---
-------->AHL12(1) <-----------GT1                 <---------ARR11(3) <---------At4g35610  ------>MYB83
--------AHL12(2)<---------YAB1        <---------KAN1   <---------CCA1(2)--------->MYB52(1)------>MYB46(1)
 
aaaatttcttttagttattattttcgtttttcaatagcagaataaaacttcaagttctctatcttaagatggtgctaactgctaaaataaaccaaatgaa  7938900
                                                                                --------->AHL20(2)
                                                                         <<<<<<<<<<GT-3b
                                                                       <---------YAB1
                                                                       <---------AHL12(2)
                                                                       --------->AHL12(2)
                                                                      --------->AHL12(3)
                                                                      <---------AHL25(2)
                                                                      <---------AHL12(3)
                                                                      --------->AHL25(2)
                                                                      <---------AHL20(3)
                                      --------->ARR14(2)              --------->AHL20(3)
                                      <---------ARR14(2)              <---------AHL25(3)
                            <---------AHL20(2)                        <---------AHL12(2)
                      --------->AHL12(3)                             --------->YAB1
                      <---------AHL12(3)                             <--------HAHB4
                      <---------AHL25(2)                             -------->ATHB1 <---------AHL25(1)
                     --------->AHL25(3)                              --------->AHL25(1)
                     <---------AHL25(2)                              --------->AHL12(3)
                     --------->AHL25(2)                              <---------AHL12(1)
                     --------->AHL25(1)                              --------->AHL20(2)
                     <---------AHL20(1)                              <---------AHL20(2)
                     <---------AHL20(2)                              --------->AHL12(1)
                     --------->AHL20(2)                              --------->AHL25(3)
            --------->ARR14(2)        --------->GATA12  <---------YAB5--------->AHL12(2)
    --------->AHL25(1)--------->AHL25(2)           ------>MYB46(1)   <---------ICU4 --------->AHL20(2)
    <---------AHL20(3)<---------AHL25(3)           ------>MYB83      <---------AHL25(1)
    <---------AHL12(3)<---------AHL25(1)         --------->TOE2(2)   --------->ATHB51
    --------->AHL20(2)--------->AHL25(1)         --------->TOE1(2)   <---------AHL25(3)            -
    --------->AHL20(3)<---------AHL20(2)  <----------DOF2           <---------ATHB12<---------AHL20(2)
----------ID1        --------->AHL12(1)   ------>ZmHOX2a(1)         --------->AHL25(3)             -
---------->GT1       <---------AHL12(1)  --------->TOE2(3)          <---------ATHB51--------->AHL25(1)
------->DOF2<---------ZAT18 --------->AHL20(2)<-----------GT1       --------->ICU4  --------->AHL12(3)
------>DOF5.7(1)------>ZmHOX2a(1)--------->RVE1(2) -------->P <-----------GT1<----------DOF2 -------
 
aaaagaaaaaaatagggtcctcaatttttttttaaatatcaaatcctttaaacctactagacatttttccaattatttttcttttatataattcaagaga  7939000
                                      <---------YAB1
                                    <-----------GT1
                             --------->AHL20(3)
                             --------->AHL12(3)
                             <---------AHL12(3)
                             --------->AHL20(2)
                             --------->AHL25(2)
                            <---------ICU4                               --------------->AGL15
                          --------->AHL12(2)                             <---------------AGL15
                        <---------AHL20(2)                              ----------------->AGL2
--------->DAG2          --------->AHL25(3)                              ----------------->AGL3
-------->DOF5.7(1)    --------->AHL12(2)                                ----------------->AG -------
--------->DOF2<----------DOF2<---------AHL20(3)                         ----------------->AGL1   <--
---->GT1<----------DOF2 --------->AHL20(2)                --------->ANAC55(2)      ----------->RAV1(1)
 
aaaaaagtattctttagctttagttttttaatttttatattactattgacaaaatttgtttatgtaatagcagtttccaaattcagccacataaaacatt  7939100
<- Previous    Next ->

AGI:  At4g13640.1   
Description:  UNE16 (unfertilized embryo sac 16); transcription factor. similar to myb family transcription factor [Arabidopsis thaliana] (TAIR:AT3G24120.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO43550.1); contains InterPro domain Homeodomain-related; (InterPro:IPR012287); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Myb, DNA-binding (InterPro:IPR014778); contains InterPro domain Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447)
Range:  from: 7936588    to: 7938635    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g13650.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT5G09950.1); similar to pentatricopeptide, putative, expressed [Oryza sativa (japonica cultivar-group)] (GB:ABA99524.2); similar to hypothetical protein OsJ_035025 [Oryza sativa (japonica cultivar-group)] (GB:EAZ20816.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO23492.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 7938963    to: 7942894    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version