AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                   <---------AHL12(1)
                                   --------->KAN1
                                  --------->AHL12(3)
                                  <---------AHL12(2)
                                  --------->AHL25(1)
                                  <---------AHL12(1)
                                  <---------AHL25(1)
                                  <---------AHL25(3)                                              --
                                  --------->AHL12(1)                                              <-
                     <---------ARR11(3)                                                           <-
                     --------->AHL20(2)                                                           <-
                     <---------AHL25(3)                                                           --
                     <---------AHL20(1)                                                           <-
                     --------->ARR11(3)                                                           <-
                     --------->AHL12(1)                                                           --
                     --------->AHL20(1)                                                           <-
                     <---------AHL20(2)               <---------ARR11(3)                          --
                     --------->AHL25(1)        <-------GAMYB                                     <--
                     --------->AHL20(3)       <---------ANAC58                                   <--
                     <---------AHL20(3)       <---------ANAC58                                   ---
                     --------->AHL25(2) <---------ANAC58                                    --------
              --------->RVE1(2)   --------->AHL25(2)  --------->ARR11(3)                 --------->DOF5.7(1)
         --------->ANAC58        --------->AHL20(2)   --------->ARR14(3)           --------->At5g28300
         --------->ANAC58        --------->AHL25(1)   <---------ARR14(2)          ----------->GT1---
       ---------->DOF2           --------->AHL12(3)   <---------ARR14(3)        <---------LBD16 <---
    --------->ANAC58 <---------AHL25(1) <---------ANAC46         --------->ANAC46<---------TOE2(3)--
    --------->ANAC58 <---------AHL25(2) <---------ANAC58    <---------RVE1(2)   <---------At5g28300
  --------------->AGL15          --------->AHL25(3)   --------->RVE1(2)--------->RVE1(2)--------->DOF5.7(1)
->DEAR3(1)    --------->GATA12   --------->AHL25(2)   --------->ARR14(2)       <-----------GT1  ----
-------------WRI1   <---------KAN1<---------AHL25(2) <---------KAN1 <---------GLK1(2)  --------->DOF5.7(1)
>RAP2.3(1)    <---------GATA12   <---------AHL25(2)  --------->RVE1(1)<---------KAN1   ---------->DOF2
 
ttaaaccaagtaaagcaaatcgaatatattgttcaaaaaaattccttgtgcgttgaatatcttgatatacagaatatcaattttacggtaaaaaggagta  22158900
                                                                   --------->AHL20(1)
                                                                   <---------AHL20(2)
                                                                   --------->AHL20(3)
                                                                   <---------AHL25(2)
                                                                   <---------AHL20(3)
                                                                   <---------AHL12(2)
                                                                   --------->AHL25(2)
                                                                  <---------ICU4
                                                                  <---------AHL12(1)
                                                                  --------->AHL12(1)
                                                                  <---------AHL25(2)
                                                                  --------->AHL25(3)
                                                                  <---------AHL12(3)
                                                                  --------->AHL25(1)
                                                                  --------->AHL12(3)
                                                                  --------->ATHB51
                                                                  <---------AHL25(3)
                                                                  --------->AHL20(2)
                                                                  <---------AHL20(2)
                                                                  <---------AHL25(1)
                                                                 --------->ICU4
                                                                 <---------YAB5
                                                                 --------->AHL25(3)
                                                                --------->WOX13(2)
                                                                <---------AHL12(2)
                                                                --------->AHL12(2)
                                                                <---------WOX13(2)
                                                               <---------AHL25(3)
                                                              --------->AHL20(1)
                                                              --------->AHL12(3)
                                                              --------->AHL12(1)
                                                              --------->AHL20(2)
                                                              <---------AHL12(1)
                                                              <---------AHL25(2)
                                                              --------->AHL25(2)
                                                              <---------AHL25(1)
                                                              <---------AHL12(3)
                                                              --------->AHL25(1)
                                                              <---------AHL20(2)
                                                              <---------AHL25(3)
                                                             <---------AHL20(3)
                                                             --------->AHL25(3)
                                                             <---------AHL12(3)
                                                             --------->AHL12(3)
                                                             <---------AHL25(1)
                                                             <---------AHL20(2)
                                                             --------->AHL20(2)
                                                             --------->AHL20(3)
                                                             <---------AHL25(2)
                                                            <---------AHL12(2)
                                                            --------->AHL12(2)
      <-----------GT1                                       --------->WOX13(2)
    --------->WOX13(2)                                      <---------WOX13(2)
  <---------AHL20(2)                                       <---------AHL12(2)
------->ATHB51                                            --------->AHL12(1)
--------AHL25(1)                                          --------->AHL20(2)
--------ICU4                                              --------->AHL20(3)
--------AHL20(2)                                          --------->AHL25(1)
------->AHL12(1)                                          --------->AHL20(1)
--------AHL25(3)                                          <---------AHL20(3)
--------AHL12(1)                                          --------->AHL25(2)
------->AHL20(2)                                          <---------AHL25(2)
--------AHL12(3)                                          <---------AHL20(1)
------->AHL25(1)                                          <---------AHL25(3)
-------YAB1                     <---------HSFB2a(2)       <---------AHL12(1)
-------YAB5                 ------->GAMYB                 <---------AHL25(1)
------>ICU4              <-----------GT1                  --------->AHL25(3)
--->GT1             --------->YAB1                        <---------AHL20(2)
------>AHL25(3)    <---------YAB5                        --------->AHL25(3)                     >>>>
------AHL12(2)    <---------WOX13(1) <---------KAN1    --------->YAB1     <-----------GT1       <---
------->AHL12(3) xxxxxxxxxxxxxxxx>smallRNA(i)   --------->YAB5--------->AHL25(3)               -----
----->AHL12(2) <---------YAB1   --------->HSFB2a(2) ----------->GT1<---------AHL25(3)         <-----
 
attatttagttaccaattgtgaatgatataactgtctggaataaatgcaaatgactagtaataaattaattattttgttaccaaaaacaaaatgggtttg  22159000
                                                                          <----------DOF2
                                                           <---------AHL20(2)                   <---
                                                           <---------AHL25(3)                  -----
                                                           --------->AHL12(1)      <---------DOF5.7(1)
                                                          --------->AHL25(1)     <---------DOF5.7(1)
                                                          --------->AHL12(3)    --------------->AGL15
                                                          <---------AHL12(3)    ====================
                                                          --------->AHL20(2)    <---------------AGL15
                                                          <---------AHL25(1)  <-----------GT1 ------
>>>>>ARR2         <---------ARR11(3)                      --------->AHL25(3) <-----------GT1  ------
------RVE1(2)     --------->RVE1(2)              --------->ATHB12        <---------DOF5.7(1) <------
---->ATHB12       <---------GATA12              <---------KAN1   <---------RVE1(2)<----------DOF2 <-
----YAB1          --------->GLK1(2)   <----------DOF2----------->GT1 <-----------GT1 ---------->DOF2
 
attgtattgggccagtccaaaaatctgaagcccatttatgtctttaaacggatgaatggaaataaatcgatattactcttttacccttttaagccgattt  22159100
                                                                                                  <-
                                                                                                ----
                                                                                                ----
                                                                                               -----
                                                                                               -----
                                                                <---------MYB52(1)             -----
                                                                <---------ARR11(2)            ======
                                                                --------->ARR11(2)            ------
                                                               <-------GAMYB                  ------
                                                               <-----------HVH21             =======
                                                        <----------DOF2                      <------ZmHOX2a(2)
                               ---------->DOF2         <---------DOF5.7(1)                   <------
       <---------ANAC46     ------>ZmHOX2a(1)         <----------DOF2                       --------
      <---------LBD16      --------------->AGL15      <---------DOF5.7(1)                   <-------
  <----------DOF2          --------->TOE2(3)   <---------MYB52(2)                           <-------
  <---------DOF5.7(1)      <---------------AGL15------->GAMYB --------->ANAC46              --------
 <---------DOF5.7(1)      <-----------------AG <---------MYB55(2)          <-----------GT1  <-------
 <---------DAG2         --------->ARR14(2)     --------->MYB46(3)     <---------DOF5.7(1)   <-------
---------CBF            <---------ARR14(2)     <------------AtMYB77<---------ANAC55(2)      --------
---->ATHB12             <---------ARR11(3)    --------->At4g35610  <---------ANAC46    --------->ARR14(2)
===========================================MADS_MADS------>NtERF2  <---------ANAC58    <---------GATA12
--->AHL25(3)     <---------GLK1(1)            <---------At4g35610  --------->ANAC55(2) --------->RVE1(2)
--->AHL20(2)     --------->GLK1(1)<----------ID1<-----------RAV1(1)<---------ANAC55(1) --------->GATA12
----DOF2--------->LBD16 --------->RVE1(2)     ----------->RAV1(2)  <---------ANAC58    <---------ARR14(2)
----------GT1  <------ZmHOX2a(1)  ----------->GT1   <---------At4g35610<----------DOF2 <---------ARR11(2)
 
attgccttttgcgcagaaggatttcaaaatcctcaaaaggaaaaacagcaactgccgctctttctccgttacgtcttttcactctctgcaaatcggatcc  22159200
                                                                                         <---------AHL12(1)
                                                                                         <---------AHL25(1)
                                                                                         <---------AHL20(2)
--------ALFIN1                                                                           --------->AHL20(2)
-->NtERF2                                                                               <---------ATHB12
----->LBD16                                                                            <---------WOX13(2)
---->ANAC58                                                                     <----------DOF2
---->ANAC46                                                                    ------>ZmHOX2a(2)
---->ANAC58                                                                    <---------DOF5.7(1)
===========================HOX2a_HOX2a                                        <------ZmHOX2a(2)
--->MYB46(3)                                                                 <---------AGP1
>ZmHOX2a(2)                                                                  --------->ARR11(3)
===========================HOX2a_HOX2a                                       <---------RVE1(2)
---ATERF1(1)                                                                 --------->AGP1
->ARR14(2)    <---------YAB1                                                 --------->GATA12
--ARR14(2)    <---------YAB5                                                 <---------GATA12
--GATA12    <---------ICU4                                                   <---------ARR11(3)-----
->ARR11(2)  --------->YAB1                                                  <---------CCA1(2)<------
--RVE1(2)--------->YAB1                                                --------->WOX13(2)--------->AHL25(1)
--ARR11(2) <---------YAB5    <<<<<<<<<TBF1        <----------DOF2 --------->RVE1(2)    --------->WOX13(2)
->GATA12<-------TEIL------>ZmHOX2a(1)     --------->KAN1          --------->TOE2(3) ------------>CBF
 
gccactacaaattcatcatcatcctcgtcttcttcttctcttcaaatattaggctttgaaaagtttcaacatcaaatttagatctttcccaattaatccg  22159300
                                                                                --------->ARR11(3)
                                                                   --------->ATHB51
                                                                   <---------AHL20(2)
                                                                   <---------AHL12(1)
                                                                   --------->AHL25(1)
                                                                   <---------AHL25(3)
                                                                   --------->AHL20(2)
                                                                   <---------ICU4 ------>ZmHOX2a(2)
                                                                   --------->AHL12(1)
                                                                   <---------AHL25(1)
                                                                   --------->AHL25(2)
                                                                   --------->AHL12(3)
                                                                   <---------AHL12(3)
                                                                  --------->AHL25(3)
                                                                  --------->AHL12(2)
                                                                  <---------AHL20(2)
                                                                  <---------AHL25(1)
                            <---------ANAC58                      --------->ICU4<---------ARR11(3)
                            <---------ANAC58                      <---------AHL12(1)
                            <---------ANAC46                      --------->AHL12(1)
                            --------->KAN1                        --------->AHL25(2)
                         --------->ARR11(2)                       <---------AHL25(2)
               ------>ZmHOX2a(1)                                  --------->AHL25(1)
<------------CBF         <---------ARR11(2)--------->YAB1         <---------AHL12(3)
---->LBD16     --------->HSFB2a(2)   <-----------GT1     <----------DOF2     <---------TOE1(2)
---LBD16       <---------HSFB2a(2)--------->GATA12      <---------DOF5.7(1)  <---------TOE2(2)
 
gtctattgccatgtcttcctcgaagaaggttacgttcgattcacaatcttcatttcttctctttatgaaattatttctcgtatgatcttagtttttctct  22159400
             =================================HOX2a_HOX2a                                <---------MYB46(3)
             =====================HOX2a_HOX2a                                           ------>ZmHOX2a(2)
             ------>ZmHOX2a(2)                                                         <------ZmHOX2a(2)
            ======================HOX2a_HOX2a                                         --------->ARR11(2)
            <------ZmHOX2a(2)                                                         --------->ARR14(2)
            ==================================HOX2a_HOX2a                             <---------ARR14(2)
           --------->GATA12                            <---------GATA12               --------->GATA12
           <---------GATA12                            --------->ARR14(2)             <---------GATA12
           --------->ARR11(2)                          --------->GATA12               <---------ARR11(2)
           <---------ARR11(2)                    --------->DOF5.7(1)                --------->LBD16
           --------->ARR14(2)                    --------->DAG2                   <---------LBD16
           <---------ARR14(2)             ----------->GT1                      <---------GLK1(1)
      <---------ARR11(2)                 ----------->GT1                      --------->GATA12
      --------->ARR11(2)             <---------TOE2(3) <---------ARR11(2)     <---------GATA12
      <---------ARR14(2)        <---------MYB46(3)     <---------ARR14(2)     ------->TEIL
      --------->ARR14(2)   <------ZmHOX2a(1)    ---------->DOF2              <---------GLK1(2)
 <---------LBD16       <---------ATHB12<------ZmHOX2a(1)  <---------LBD16    <---------CCA1(2)
 
gatttcagggttccgatcggaatcaaatcaggaagtcgttgaggaagttaaaaaagcagattggggaattggagaaacttgaatctccggatcggttgaa  22159500
                                                                                               <----
                                                                                    --------->AHL12(3)
                                                                                    <---------AHL12(3)
                                                                                    --------->AHL25(1)
                                        <-----------HVH21                           <---------AHL25(1)
                               ------>ZmHOX2a(1)                                    <---------AHL20(2)
                               <----------DOF2                                      --------->AHL25(3)
                      --------->ZAT18  <---------bZIP60(1)                          --------->AHL25(2)
                      --------->ZAT14  --------->bZIP60(1)      <---------YAB5      <---------AHL25(2)
                      <---------ZAT18<-------GAMYB      <---------AHL25(1)          <---------YAB1 -
                 ---------->DOF2    <-----------RAV1(1) --------->AHL12(3)         <---------AHL20(3)
           --------->YAB1  <---------ARR11(3)           <---------AHL20(3)         --------->AHL12(2)
         <---------ARR11(2)--------->ARR14(2)           --------->AHL20(3)         --------->AHL20(3)
         --------->ARR11(2)<---------ARR11(2)           <---------AHL12(3)         <---------AHL12(2)
         --------->ARR14(2)--------->RVE1(2)            <---------AHL20(2)         --------->AHL25(2)
         <---------ARR14(2)<---------ARR14(2)           <---------AHL25(2)        <---------KAN1 ---
        <---------CCA1(2)  --------->ARR11(2)   <---------ARR11(3) --------->AtLEC2<---------AHL25(2)
 
taatgtgaagcctatcttcatcaagcgcagtatccttttctgttgtcacaagatgctatttttttttgtcatacaaaactgtggaatattatttgttttc  22159600
                                                                    --------->GLK1(2)
                                                                   <---------ARR14(2)
                                                                   --------->ARR14(2)
                                                                   --------->KAN4(2)
                                                                  <---------KAN4(1)           ------
                                                                  --------->KAN4(1)        ------>ZmHOX2a(1)
                                                                  <---------KAN1         ------>ZmHOX2a(2)
                                                                  <----------TaMYB80    <------ZmHOX2a(2)
                                                                  --------->KAN1       --------->ARR11(2)
                                                           <---------ICU4              <---------GATA12
                                >>>>>>>>>TBF1             <------ZmHOX2a(2)            --------->ARR14(2)
                          <---------------AGL15          --------->ARR11(3)            <---------ARR14(2)
         <------MYB83     --------------->AGL15          <---------ARR11(3)            --------->GATA12
         <------MYB46(1)  ==========================================================================
     <---------ZAT2    <---------AHL20(2)               --------->YAB1                 <---------ARR11(2)
     --------->ZAT2--------->CCA1(2)                    <------ZmHOX2a(1)              --------->ARR11(3)
-------GT1        --------->ARR11(3)                  <---------TOE1(3)                <---------RVE1(2)
---------->HVH21  <---------ARR11(3)                  <---------TOE2(3)           <---------ANAC46
------>ANAC55(2)<---------TOE2(3)              ---------->DOF2   ---------->TaMYB80 <---------TOE1(2)
 
acatgacgagcttggttttaagatatatacttgaagaagaaactcaagaagaaagttaaggatcatggcatattctgttcttgctccttggatcctggtt  22159700
                                                                                 <------NtERF2
                                                                                ------>NtERF2
                                                                                <---------RAP2.3(1)
                                                                               <---------ANAC46
                                         --------->ARR11(2)                    --------->ATERF1(2)
                                         <---------ARR14(2)                    <---------ATERF1(2)
                                         <---------ARR11(2)                    <---------bZIP60(1)
                                         --------->RVE1(2)                     <---------RAP2.3(3)
                                         <-----------ARR10                     <---------RAP2.3(2)
                                         <---------ARR11(3)                    <---------DEAR3(1)
                                         --------->ARR14(2)                    <---------RAP2.6(2)
              <---------At4g35610       <---------CCA1(2)                     <------NtERF2
       <-----------RAV1(1)           ----------------->AGL1                   --------->RAP2.6(3)
     <----------DOF2             <---------HSFB2a(1)                  --------->AHL12(1)
   <---------------AGL15         --------->KAN1         <---------ANAC58  <---------ANAC58     <----
   --------------->AGL15         --------->HSFB2a(1)    <---------ANAC58  <---------ANAC58    <-----
--->ARR14(2)  <------NtERF2<---------ANAC46         --------->ANAC58  <---------AHL12(1)   <--------
===================MADS_MADS    <---------KAN4(2)   --------->ANAC58  --------->KAN1  <---------MYB46(3)
 
cttcaactctttgtggcagcgattgcaattgtgggtatgttccatatctgatcacaagtacttgtctgactaaatattcgtggcggcattggttctgatt  22159800
<- Previous    Next ->

AGI:  At3g59960.1   
Description:  ASHH4 (HISTONE-LYSINE N-METHYLTRANSFERASE ASHH4). Identical to Putative histone-lysine N-methyltransferase ASHH4 (ASHH4) [Arabidopsis Thaliana] (GB:Q9M1X9); similar to ASHH3 (HISTONE-LYSINE N-METHYLTRANSFERASE ASHH3) [Arabidopsis thaliana] (TAIR:AT2G44150.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO62064.1); contains InterPro domain Post-SET zinc-binding region; (InterPro:IPR003616); contains InterPro domain AWS (InterPro:IPR006560); contains InterPro domain SET; (InterPro:IPR001214)
Range:  from: 22159311    to: 22161363    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version