AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                  --------->YAB1
                                  <-----------GT1
                                 <---------YAB1
                               <---------ICU4
                               --------->YAB1
                              --------->AHL12(1)
                              <---------AHL12(1)
                             <---------AHL20(3)
                             --------->AHL12(2)
                             <---------AHL12(2)                                             --------
           <---------YAB1    --------->AHL20(3)     --------->WOX13(2)              --------->ATHB12
    ---------->DOF2     ----------->GT1            ----------->GT1                 <---------YAB5 --
  --------->YAB1  >>>>>>>>>>>>>>>>>LFY         --------->MYB111(1)           <----------DOF2--------
--------->RVE1(2) <<<<<<<<<<<<<<<<<LFY        <--------P                 <---------GLK1(2) <--------
 
taaaatcaaaagctatcaatgttccaatggaaaattatcacagtacttggtaagtagttaacaaactttgaacacagtttcttttattcattagatgatt  24218200
    ------>ZmHOX2a(2)
   <---------GLK1(1)
   --------->GLK1(1)
   <------ZmHOX2a(2)
  <---------ARR14(3)
  <---------ARR14(2)
  --------->GATA12
  <---------ARR11(3)
  --------->ARR14(2)
  --------->RVE1(2)
  <---------GATA12                             <-------TEIL
  --------->ARR11(3)                          --------->CCA1(2)
  --------->ARR14(3)                         <---------ARR14(2)                        --------->AHL20(2)
 --------->RVE1(1)                           <---------ARR11(2)                      <---------WOX13(2)
<---------YAB5                         --------->ARR11(2)                            --------->WOX13(2)
->YAB5     <----------DOF2             <---------ARR11(2) --------->RVE1(2)      <---------ANAC55(2)
-------->DOF2                       --------->ANAC46--------->RVE1(2)        --------->YAB1
->ATHB12 <---------TOE1(2)     --------->ZAT6--------->ARR14(2)             <---------YAB1
-YAB1   ------>ZmHOX2a(1)    <-----------GT1 --------->ARR11(2)<---------TOE2(3) --------->ANAC55(2)
 
gtaaagatctcctactttctcaaatttcttataaactctacagaaccagatacaaaatcaaactctaaggctctaagctataatacttaatgaaataagc  24218300
                                                                                             -------
                                                                                            <-------
                                                                                           ---------
                                                                                          --------->ARR14(2)
                                                                                     ----------->RAV1(1)
                           <----------ID1                                           --------->AtMYB61
                        --------->DAG2                                              <---------ALFIN1
                        --------->DOF5.7(1)               --------->ANAC55(2)    <---------ALFIN1
                       ---------->DOF2                    --------->ANAC46       --------->DEAR3(1)
                   ----------->GT1                 <----------DOF2               --------->AtMYB61
                 <---------GATA12                  <---------DOF5.7(1)        --------->AtMYB61
             <---------At4g35610           --------->ANAC58   --------->RVE1(2) --------->MYB46(3)
             --------->At4g35610           --------->ANAC58 --------->KAN1    <---------ALFIN1
            ----------->RAV1(1)          ---------->DOF2<-----------GT1    --------->ZAT6 <---------GLK1(2)
          --------->At4g35610   --------->ANAC58  --------->TOE2(3)        --------->ANAC46---------
          <---------At4g35610   --------->ANAC58  <---------DOF5.7(1)--------->YAB1--------->MYB46(3)
 
acaaaattcaaacagcagcagattgtaaaagcgacaagacaaacaaaagcaaacctttttcacataatccattgatgaacaccaccaccaccagaatctc  24218400
                                                                                      --------->WOX13(1)
                                                                                     --------->YAB5
                                                                                     <---------ICU4
                                                                                    <---------YAB5
                                                                                    <---------ATHB12
                                                                                    <---------YAB1
                                                                                    --------->ICU4
                                                                                  ------>MYB46(1)
   --------->ARR14(2)                                                             ------>MYB83
   <---------ARR14(2)                                                           <---------MYB59
   --------->ARR11(2)                                                          --------->ANAC55(2)
   <-----------ARR10                                                           <---------ANAC55(2)
   --------->RVE1(2)                                                         <-----------GT1
   <---------ARR11(3)                      --------->ARR11(3)             <-----------GT1
   <---------ARR11(2)             ---------->DOF2 <---------ANAC58       <---------AHL20(2)
  <---------CCA1(2)   <---------WOX13(2)   <---------RVE1(2)             --------->AHL25(1)
-->RVE1(2)           ------>MYB46(1)       <---------ARR11(3)   <---------ANAC58<---------MYB46(2)
--KAN1               ------>MYB83 --------->DOF5.7(1)      <---------RVE1(2)<---------YAB5
>GLK1(2)   ----------->GT1    ------->GAMYB<---------GLK1(2)    <---------ANAC58<---------MYB111(1)
>RVE1(2) <---------ANAC46    --------->MYB46(3)   <---------ANAC58       --------->AHL20(2)
 
tcaccatatctgacttgaaaaaccaaattacaaccaaaaaagaacagatttttgcttaatctgatttgcttagcatttaatcacctaatcattcaaaaat  24218500
        ------->TEIL
        <---------ARR14(2)
        <---------ARR11(2)
        --------->ARR11(2)
        <---------ARR11(1)
        --------->ARR14(2)                  ------>MYB46(1)                     <---------AHL20(2)
        --------->RVE1(2)              --------->ARR11(2)                       --------->AHL20(2)
       <---------ARR14(1)           <---------HSFB2a(2)                        --------->AHL20(2)
       <---------CCA1(2)    --------->MYB46(3)                                <---------AHL12(2)
     <---------ANAC58       <---------MYB111(2)                             --------->AHL12(1)
     <---------ANAC55(2)   ------>MYB83<---------ARR11(2)                   <---------AHL12(1)
     <---------ANAC58      ------>MYB46(1)  ------>MYB83                ----------->GT1
     --------->ANAC55(2)  --------->ANAC46<---------MYB59             ---------->DOF2
  <---------RVE1(2)<----------DOF2  --------->HSFB2a(2)           ---------->DOF2        *TSS     --
<---------YAB1 <<<<<<<<<<GT-3b  <----------DOF2                <---------KAN1<---------WOX13(2)   --
 
gttttgattcgtatctatttttcttttaccaacaactttacagaaccaaattgctactaaaatagaataaaaagaaagaaaatttaaaaaacttgataga  24218600
                                                                                                  --
                                                                                <---------TGA1a   <-
                                                                                --------->TGA1a   <-
                                                                                <---------O2      --
                                                               <---------AHL20(2)                 <-
                                                               --------->AHL20(3)            =======
                                                               <---------AHL20(3)           >>>>>>>>
                                                               <---------AHL25(2)         <---------MYB52(2)
                                                               --------->AHL25(2) --------->ALFIN1<-
                                                             --------->AHL12(2) <---------bZIP60(1)
                                                             <---------AHL12(3) <---------ANAC58  --
                                                             <---------AHL25(2) <---------ANAC46  <-
                                                             <---------AHL20(2) --------->ANAC55(2)
                                              --------->DAG2 --------->AHL25(1) <---------bZIP60(2)
                                             --------->DOF5.7(1)<---------YAB1  <---------ANAC58 ---
                                             --------->DAG2  <---------YAB1     <---------ANAC55(2)
                                  ----------->GT1            --------->AHL25(3) --------->O2--------
                                  <---------MYB46(3)       <---------RVE1(1)    --------->bZIP60(1)
                                 <---------AtMYB61        --------->ARR11(3)    ====================
                                 --------->ALFIN1         <---------ARR11(3)   <--------------------
                               <------MYB46(1)--------->DOF5.7(1)              ----------->bZIP910(1)
                               <------MYB83 ---------->DOF2<---------CCA1(1)   ----------->STF1  ---
                              --------->MYB111(2)         <---------RVE1(2)   <---------TGA2(2)-----
     <------ZmHOX2a(1)        <---------AtMYB61           <---------ARR14(2) ----------->TGA1-------
  --------->At4g35610         --------->MYB111(1)       ----------->ARR10    ----------->HVH21 -----
------->GLK1(2)               <---------DEAR3(1)<-----------HVH21     <---------RVE1(2) <-----------ARR10
------->RVE1(2)     <---------RVE1(2)       ==============================================bZIP_DOF<-
 
gaatcagaggaagagaagactgggattttttgggaggtggtagaacaaaaaggtcagagaagatattattttggagtttgatgacgtggcagaactaacc  24218700
 <-----------HVH21
------->ANAC55(2)
--------ANAC46
--------TGA1a            --------->ANAC46             --------->RVE1(2)
------->TGA1a            --------->ANAC58     --------->ALFIN1
--------ANAC58           --------->ANAC58   =========================bZIP_DOF
========MYC_MYB        <-----------GT1      <---------ANAC55(1)
>>>MYB80            <---------AHL12(2)      <---------ANAC58
--------ANAC55(2)   <---------WOX13(2)      <---------bZIP60(2)
------->O2          --------->WOX13(2)      <---------ANAC58
--------O2          --------->AHL12(2)      <---------TGA1a
--->MYB83          <---------AHL12(3)       <---------ANAC46
->MYB52(1)         <---------AHL20(3)       --------->TGA1a
==MYC_MYB          --------->AHL20(3)       ===========================================MYC_MYB
---TaNAC69(2)     <---------AHL12(1)        --------->O2                        <------MYB83
--->MYB46(1)      --------->AHL20(2)       ----------->STF1                     <------MYB46(1)
---->TOE2(2)      --------->AHL25(3)       <-----------------------TaNAC69(2)   <---------MYB46(3)
->P       <------ZmHOX2a(1)              ----------->HVH21                     <---------AtMYB61<---
---->TOE1(2)      --------->AHL12(1)     ----------->TGA1 ---------->DOF2     <--------P <----------DOF2
--------ANAC58----------->GT1 <---------ZAT2<---------O2--------->YAB1      --------->ALFIN1  <-----
 
tacgtgtcaagtaggaccagataaatttacgcatgctgagattagtgacgtggacaaaatcaaaagcttggactgcgaggggttggtttagactttagag  24218800
                         <-----------GT1
                <---------YAB1
              --------->ATHB51
              <---------AHL25(3)
              <---------ICU4                                                      --------->ANAC46
              --------->ATHB12                                                    <---------ALFIN1
              -------->ATHB1                                               --------->ARR11(3)
             --------->AHL25(2)                                            <-----------GT1
             --------->AHL25(3)                                            <---------ARR11(3)
             <---------AHL25(2)                                          <---------YAB1
             --------->AHL12(1)                                         --------->AHL20(3)
             <---------AHL25(1)                                         <---------AHL20(3)
             --------->ICU4                                             <---------AHL25(2)
             --------->AHL20(2)                                        <---------ICU4 --------------
             <---------AHL20(2)                                        --------->YAB1 --------------
             <---------ATHB51                                         --------->ICU4--------->ANAC46
             <---------AHL20(3)                                      <---------AHL20(3)
            --------->AHL12(2)                                       --------->AHL20(3)
          <---------AHL20(2)                        <---------MYB52(1)<---------YAB1--------->ANAC58
          --------->AHL20(2)                   <-----------GT1       <---------AHL25(2)
      ----------->GT1 --------->GATA12    <---------ANAC55(2)        <---------AHL12(2)       ------
 --------->ETT(2)     <---------GATA12    --------->ANAC55(2)        --------->AHL12(2)     --------
------GLK1(2)<---------AHL12(1)         --------->AHL20(2)           --------->AHL25(2)-------------
----RVE1(2)--------->AHL12(2)           <-----------GT1           <---------GLK1(2) --------->ANAC58
 
attatcgacatgttaaattattgtcgatttacaacaaaacaaattacatatttccatttgtttcagatagattattattatcttcacacaccaaaaaaag  24218900
                   <---------ANAC55(2)
                   --------->ANAC58
                   --------->ANAC58
                --------->ARR11(2)
                <---------ARR11(2)
           ------------>AtMYB77
      --------->ARR11(3)
   <---------AHL25(1)
   --------->AHL20(2)
   <---------AHL20(2)                      <------------CBF                              <----------DOF2
   --------->AHL25(1)                      --------->WOX13(2)                      <---------DOF5.7(1)
   --------->AHL20(3)                ----------->GT1                               <----------DOF2
   <---------AHL20(3)               --------->DOF5.7(1)               <---------MYB111(1)<----------
--->AGL3  <---------YAB1           --------->DOF5.7(1)   --------->DOF5.7(1)       <---------DAG2
--->AGL2--------->YAB5             ---------->DOF2       --------->DAG2 ------>MYB83     <---------DOF5.7(1)
--->DOF5.7(1)  <-------GAMYB  ----------->GT1           --------->DOF5.7(1)    <-----------GT1 -----
-->DOF2 <---------ICU4      ---------->DOF2<---------WOX13(2)        --------->ANAC46 ---------->ID1
-->AGL15--------->YAB1 ---------->DOF2----------->GT1   ---------->DOF2 ------>MYB46(1)  <---------DAG2
 
atagattaaaatcatgacagttacgaaaatgcaaagaaaaaaggaaaattgacaaaacaaaaaggaaactccaccaaataagtttccttttccttttcct  24219000
                                                                               ------>ZmHOX2a(2)
                                                                              --------->GLK1(1)
                                                                              <---------GLK1(1)
                                                                              <------ZmHOX2a(2)
                                                                             --------->ARR14(2)
                                                                             <---------AGP1
                                                                             <---------ARR14(2)
                                                                             <---------ARR11(3)
                                                                             --------->RVE1(2)
                                                                  --------->ANAC46
                                                                --------->ANAC58
                                                         --------->KAN1      --------->ARR11(3)
                                                     ----------->TBP<---------KAN1
                          ----------->GT1            --------->AHL20(2)      <---------GATA12
                   --------->YAB1                  <---------HSFB2a(2)       --------->GATA12
  --------->KAN1 <------------CBF             <---------DAG2    --------->ANAC46
-----AGL15 <---------ANAC46                   <----------DOF2   --------->ANAC58       --------->YAB1
->ZmHOX2a(1) <---------ANAC46      ---------->DOF2 --------->HSFB2a(2)      <---------CCA1(2)     --
 
agtagtaatccgagttgtgtaattgtaactagaaaaacaaaagccctaacttttctataaatactctacgcatcaccacagatctctcattcacaagtct  24219100
<- Previous    Next ->

AGI:  At5g60100.1   
Description:  APRR3 (PSEUDO-RESPONSE REGULATOR 3); transcription regulator. Identical to Two-component response regulator-like APRR3 (APRR3) [Arabidopsis Thaliana] (GB:Q9LVG4); similar to APRR9 (PSEUDO-RESPONSE REGULATOR 9), transcription regulator [Arabidopsis thaliana] (TAIR:AT2G46790.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO21763.1); contains InterPro domain Response regulator receiver; (InterPro:IPR001789); contains InterPro domain CheY-like (InterPro:IPR011006); contains InterPro domain CCT (InterPro:IPR010402)
Range:  from: 24215225    to: 24218590    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version