AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
    <---------ICU4               <---------ANAC58                                   ---------->DOF2
    --------->YAB5               <---------ANAC58                         --------->DOF5.7(1)  <----
    --------->YAB1          --------->YAB5                           --------------->AGL15    ------
   <---------YAB1           <---------ICU4                        --------->KAN1   <---------MYB52(1)
-->ANAC58        <------ZmHOX2a(1)      <---------DOF5.7(1)--------------->AtSPL8 --------->TOE2(3)
-->ANAC58 <----------DOF2   --------->YAB1       <---------DOF5.7(1) <---------------AGL15    ------
aacttgatgatcactttagaggaaggcctgatcatgacttgcctcttccctctcttctcagcattgtacatactcttaagagcatcgttaagcacactga  24130300
                                      <----------ID1      <---------MYB59
                                    <-----------GT1   <---------ARR11(2)
                                 <---------WOX13(2)   --------->ARR11(2)
                                 --------->WOX13(2)   --------->ARR14(2)                        <---
<-----------GT1                 ------>MYB46(1)       <---------ARR14(2)             <---------YAB5
-----GLK1(2)                    ------>MYB83--------->ARR14(2)                     --------->YAB1---
--->KAN1              ----------->RAV1(2)   --------->RVE1(2)  --------->TOE1(2)  <---------ATHB12
--->YAB5   ---------->DOF2    <---------MYB59     <---------At4g35610       --------->ZAT6--------->YAB5
ttctcaccatttttcaaagctcaaaacctgataccaaattaacaacaaatctgagccgataccaaacgtactaatgctaacaccaataaacattgactaa  24130400
                               --------->KAN1                           --------->ANAC58
                            <---------ARR11(2)                          --------->ANAC58
                            --------->ARR11(2)                   --------->GATA12
                            --------->ARR14(2)              <---------At4g35610
          <----------DOF2  <------ZmHOX2a(1)                <---------ZAT2 --------->MYB52(1)
         <---------DOF5.7(1)<---------ARR14(2)              --------->At4g35610 ------->TEIL
--------->WOX13(2)     --------->DOF5.7(1)         --------->ZAT14      --------->RVE1(2)
------ATHB12         ---------->DOF2               <---------ZAT14     --------->WOX13(1)
------>YAB1    <---------ZAT6 <-------TEIL --------->ZAT18  <------NtERF2<---------ATHB12
tcaaatttagtctcttttgtgttaaaaagaggattcatgcttcaaatgcacaactatagtggcagctaaatcgacaatcaacgaacttgattctaatatt  24130500
                              --------->ANAC58                      <---------WOX13(2)
                              --------->ANAC46                      --------->WOX13(2)
                            --------->MYB52(1)                      <------------CBF
                          <---------ATHB12                       ------>ZmHOX2a(2)
                          --------->MYB46(3)                    <------ZmHOX2a(2)             ------
                         --------->ANAC58                      --------->GATA12               ------
                      ------------>CBF                         --------->ARR11(3)            <------
                  ------>MYB46(1)                              --------->AGP1                -------
          --------->YAB1 --------->ANAC58                      <---------AGP1               <-------
        ------------>CBF--------->WOX13(1)     --------->ANAC58<---------GATA12     --------->ANAC46
 --------->YAB5   --------->MYB52(1)           --------->ANAC58<---------ARR11(3)   --------->ANAC58
--------->ICU4    ------>MYB83--------->ANAC58 --------->ANAC46--------->RVE1(2)    --------->ANAC58
gaaatgaatacaacaataaccaaatggcaatcaacgaaacatagaactataagcaaactttcgatagatctaattgtattctggtccaagaaactaatgt  24130600
                                                                 <---------TGA1a                 ---
                                                                 --------->ANAC46              -----
                                                                 --------->ANAC55(1)           =====
                                                                 --------->TGA1a              <-----
                                                                 --------->ANAC55(2)          ======
                                                                 --------->O2                -------
                                                                 <---------ANAC55(2)         -------
                                                                 <---------O2                <------
                                                                 --------->ANAC58            -------
                                                                 --------->bZIP60(2)         <------
                                                                 --------->bZIP60(1)         -------
                                                                 --------->ANAC58            <------
                                                                 <---------bZIP60(1)         <------
                                                               <-----------GT1               -------
                                                            <---------GLK1(1)               --------
                                                            --------->GLK1(1)               <-------
--->YAB1                   --------->TOE1(2)               <---------ARR14(2)    <---------ARR14(2)
--->TOE2(3)              ------->TEIL                      <---------GATA12  --------->At4g35610 ---
---ZAT6               <---------YAB1<---------KAN1         --------->GATA12  <---------At4g35610 <--
---->GT1    --------->At4g35610    <---------KAN4(2)=======================bZIP_DOF        ---------
--TOE2(3)   <---------At4g35610--------->HSFB2a(2)  ---------->DOF2--------->TGA2(2)  ---------->DOF2
taatcgatagcatcgagctcaaactatgaaactacgagaattttcagagaattttaaaagcagatttcacgtcatgattgagcagaaatgaaagcagatc  24130700
---------->DOF2                     ------>ZmHOX2a(2)
--->ZmHOX2a(1)                     <---------GLK1(1)
->ZmHOX2a(2)                       --------->GLK1(1)
==================HOX2a_HOX2a      <------ZmHOX2a(2)
-ZmHOX2a(2)                       --------->GATA12
==================HOX2a_HOX2a     <---------GATA12                  --------->RAP2.3(2)
-->ARR14(2)                       --------->ARR11(3)                ----------->RAV1(1)
-->ARR11(3)                       --------->ARR14(2)                --------->DEAR3(1)
---ARR11(2)                       <---------ARR14(3)                --------->RAP2.6(2)
-->RVE1(2)                        <---------ARR11(3)               --------->ATERF1(1)
---ARR14(2)                       <---------ARR14(2)               --------->RAP2.3(1)
-->ARR11(2)              --------->At4g35610                      <------NtERF2
---GATA12                <---------ZAT2                           <---------At4g35610
---ARR11(3)    ---------->DOF2   <---------GLK1(1)                <---------ZAT2
-->GATA12     <---------KAN1     --------->GLK1(1)                <---------ATERF1(1)
->GLK1(1)  ================================HOX2a_HOX2a            --------->ZAT2
--GLK1(1)  <------ZmHOX2a(1) --------->ALFIN1                     --------->At4g35610
------>HSFB2a(2)         --------->ZAT2             <---------GLK1(1)                     --------->DOF5.7(1)
-------HSFB2a(2)         <---------At4g35610        --------->GLK1(1)           <---------LBD16
-->ARR10   ===============================HOX2a_HOX2a<---------GATA12--------->LBD16    ---------->DOF2
ctagaaaggaaacaggaataaagctcgtagctgtggagatctctctaacctttggaaatcgaaaatggcagccgcacaaaaactctggagcaaaagacga  24130800
                                                    <-----------TBP  <---------YAB1
                                                  <---------DAG2<------NtERF2                      <
                                                 <---------ANAC58<----------DOF2                 ---
                                                 <---------ANAC58<---------DOF5.7(1)             <--
                                          *TSS <-----------GT1<---------RAP2.6(2)                <--
                                        <---------TOE2(3)   <---------ATERF1(1)                  ---
                                        <---------TOE1(3)  <---------RAP2.3(3)   <---------ZAT14<---
         <-----------GT1             <---------KAN1<---------DOF5.7(1)     <----------DOF2 <--------
  ---------->DOF2                   <---------WOX13(2)--------->ATHB12  ------->TEIL  ----------->GT1
agaggcaaagtttaacaagagaactaaatacaagatgcgaattagggtttttgctttttattggggcgccttatgaaactttactagactggttaatgga  24130900
  <---------YAB1                                                              <-----------HVH21
 --------->AHL20(3)                                                          --------->RRTF1(3)
 <---------AHL20(3)                                                          --------->DEAR3(1)
 --------->AHL20(2)                                       <---------ARR14(2) --------->RAP2.3(2)
 --------->AHL25(2)                            <---------YAB1               --------->DEAR4(2)
 --------->AHL20(1)                           --------->RVE1(2)             --------->RRTF1(1)
 <---------AHL20(2)                          <---------ICU4                 --------->ERF1
 <---------AHL20(1)                      <---------YAB5   <---------RVE1(2) --------->ORA47(2)
 <---------AHL25(2)                      <---------YAB1   --------->GATA12==========================
--------->YAB1                  --------->ARR11(3)        --------->ARR14(2)--------->RAP2.3(1)
---------YAB1                   --------->RVE1(2)         <---------GATA12------->GAMYB
------>YAB5                     <---------ARR11(3)      ----------->ARR10--------->MYB46(3)
-------ICU4                    --------->RVE1(1)<-----------GT1    --------->RVE1(2)--------->AHL20(2)
------HAHB4               --------->TOE2(3)--------->TOE2(3)      <---------CCA1(2) <---------AHL20(2)
------>YAB1            <----------DOF2--------->DOF5.7(2) <---------ARR11(3)--------->ATERF1(1)
---ZmHOX2a(2)         <---------DOF5.7(1)<---------TOE2(3)--------->ARR11(3)<------NtERF2
-WOX13(2) <----------DOF2 --------->YAB1<---------DOF5.7(2) ------>ZmHOX2a(2)--------->RAP2.3(3)----
tcattataatgggctttattttgggcctttcttaatatctcgttaacattatcacagcctagatcgtctatatccaagcgccgtcgtttaattggaggta  24131000
                                    <-----------TGA1                                              <-
                                    <-----------HVH21                                             <-
     --------->TGA1a            <----------DOF2                                                   --
     ==================================bZIP_DOF                                                   --
     <---------TGA1a <---------TOE2(3)  <---------At4g35610                    <---------DOF5.7(1)<-
     ==================================bZIP_DOF    --------->REM1(1)     <-----------GT1          --
===============MYC_MYB      <----------DOF2  --------->ZAT14  <---------GATA12 <----------DOF2  ----
------->ARR10        <---------TOE1(3)  --------->At4g35610   --------->GATA12 <---------DAG2   <---
agactctcacttgtgtttcaaattcaggtttctttctttcgtcagcagtatgctacaactttgcacatctccagtttttctgcttttctcagtttttgaa  24131100
--------->KAN1                          ----------->RAV1(1)
---------YAB1                           --------->AtMYB61                         --------->At4g35610
--------AHL12(2)                       --------->ANAC46                  <----------DOF2
--------AHL12(3)                     --------->ANAC46                    <---------DOF5.7(1)
------->AHL12(3)                     --------->ZAT6                     <---------DAG2           <--
------->AHL12(2)                <---------At4g35610                     <----------DOF2         <---
--------AHL25(2)                --------->At4g35610                     <---------DOF5.7(1)---------
------->AHL25(2)        <------ZmHOX2a(1)    --------->RVE1(2)        ------>NtERF2        ---------
----->AHL12(1)          =============================HOX2a_HOX2a     <---------RAP2.6(2)  <---------GLK1(2)
------AHL12(1)       <---------AtLEC2--------->REM1(1)       <---------At4g35610  <---------At4g35610
tttttattctcaaactgttctcttgcaggactctctgcttacaccacagatcaatcactgaggcaactgtttgcgccttttggtcagattacagaatcga  24131200
<- Previous    Next ->

AGI:  At5g59850.1   
Description:  40S ribosomal protein S15A (RPS15aF). Identical to 40S ribosomal protein S15a-1 (RPS15AF) [Arabidopsis Thaliana] (GB:P42798;GB:Q7GD83); similar to RPS15A (RIBOSOMAL PROTEIN S15A), structural constituent of ribosome [Arabidopsis thaliana] (TAIR:AT1G07770.1); similar to RPS15A (RIBOSOMAL PROTEIN S15A), structural constituent of ribosome [Arabidopsis thaliana] (TAIR:AT1G07770.2); similar to unknown [Solanum tuberosum] (GB:ABA46758.1); contains InterPro domain Ribosomal protein S8; (InterPro:IPR000630)
Range:  from: 24129426    to: 24130843    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At5g59860.1   
Description:  RNA recognition motif (RRM)-containing protein. similar to RNA-binding protein, putative [Arabidopsis thaliana] (TAIR:AT3G46020.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO21708.1); contains InterPro domain RNA recognition motif, RNP-1; (InterPro:IPR000504); contains InterPro domain Nucleotide-binding, alpha-beta plait; (InterPro:IPR012677)
Range:  from: 24130688    to: 24131675    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version