AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                             <---------WOX13(2)
                                             --------->WOX13(2)
                                           --------->AHL25(3)
                                           <---------AHL20(2)
                                          <---------AHL20(2)
                                          --------->AHL25(3)
                                          <---------AHL25(1)
                                          <---------AHL25(2)
                                          --------->AHL25(1)
                                          <---------AHL12(3)
                                          --------->AHL20(2)
                                          --------->AHL12(3)
                                          --------->AHL25(2)
                                         --------->YAB1
                                       <---------AHL12(2)
                                      <---------AHL25(2)
                                      <---------AHL20(2)
                                      <---------AHL25(1)
                                      --------->AHL25(2)
                                      --------->AHL12(3)
                                      <---------AHL12(3)
                                      <---------AHL25(3)
                                      --------->AHL25(1)
                                     <---------AHL20(1)
                                     <---------AHL12(1)
                                     --------->AHL20(2)
                                     --------->AHL25(2)
                                     <---------AHL25(2)                                 <---------YAB1
                                     --------->AHL12(1)                                <-----------GT1
                                     <---------AHL25(3)                             <---------AHL20(2)
                                     --------->AHL25(3)                             <---------AHL20(3)
                                     <---------AHL20(2)                             --------->AHL25(2)
                                     --------->AHL12(3)                             <---------AHL25(2)
                                     --------->AHL25(1)                             --------->AHL20(3)
                                     <---------AHL25(1)                           --------->AHL25(3)
                                    --------->AHL25(3)                       --------->DAG2
                                   --------->WOX13(2)                       --------->DOF5.7(1)
                                   <---------WOX13(2)          <---------WOX13(2) <---------YAB1
----RAV1(1)                --------->DOF5.7(1)      <------ZmHOX2a(2)       ---------->DOF2
 
gtatatgagacatttacacatatcgttggaaaaactgcaattaattttaatttcgatcaaactcccagttaaaaaaaaaaaaagtattattttcaatgta  22825500
                                                   --------->At4g35610
                                                   ===================RAV
                                                   ----------->RAV1(2)
                                                   <---------WOX13(2)
                                         <---------WRKY12
                                      ----------->GT1
                                     <---------AtMYB61
                          <---------AHL12(2)    --------->WRKY18(1)
                         --------->YAB1<-----------HVH21                                           <
                <----------DOF2  --------->ANAC46<---------WRKY45                               <---
               <---------ANAC58  --------->ANAC58<---------WRKY12                              <----
               <---------ANAC46  <---------ANAC55(2)                                           <----
               <---------ANAC58  --------->ANAC58<---------WRKY38(1)                          <-----
          <-----------RAV1(1)   <---------LBD16<-----------HVH21                          <---------
    --------->WOX13(1)  --------->ICU4<------MYB83 <---------At4g35610               ----------->GT1
 --------->RVE1(2) --------->HSFB2a(2)<------MYB46(1)     ----------->RAV1(1)      ---------->DOF2 -
 
aaactatcaatctatgtggcttttggaattataaacacgggaggtcaaatggtcaactgagccccataatatgaggtctaagtttcaaaagtaaaaccct  22825600
                <---------ANAC46
                <---------ANAC55(2)
                <---------ANAC58
                <---------ANAC55(1)                       ------>MYB83
 --------->WOX13(2)                                       ------>MYB46(1)
---------AHL20(2)                               <---------ANAC58
------DOF5.7(1) <---------ANAC58                <---------ANAC58             ---------->DOF2
-----DOF5.7(1)  --------->ANAC55(2)         <---------ANAC58             <---------TOE2(3)
------DOF2<---------AHL20(2)                <---------ANAC58          <---------YAB1<-----------GT1
----DOF5.7(1)  <-----------------------TaNAC69(2)       <---------MYB59 ---------->DOF2
--GT1    --------->AHL20(2)                 <---------ANAC46         --------->WOX13(2)
-------->AHL20(2)  --------->REM1(2)    <---------At4g35610          <---------WOX13(2)   ----------
 
ttttaaatagcataaaattgcgtgaagaagttggcactctcgatgctgcttgctcgttaccaaattggagtttattaaagtaaagttttacaaattgtac  22825700
                                                                                              <-----
                                                                                            <-------
                                                                                           ---------
                                                                                           <--------
                                                                                           <--------
                                                                                           <--------
                                                                                           ---------
                                                                                           ---------
                                                                                           ---------
                                                                                           <--------
                                                                                           <--------
                                                                                           ---------
                                                                                           <--------
                                                                                          <---------AHL12(3)
                                                                                          <---------AHL20(2)
                                                                                          --------->AHL12(1)
                                                                                          --------->AHL20(2)
                                                                                          --------->AHL12(3)
                                                                                          <---------AHL12(1)
                                                                                          <---------AHL25(2)
                                                                                          <---------AHL25(3)
                                                                                          --------->AHL25(1)
                                                                                          --------->AHL25(3)
                                                                                          <---------AHL25(1)
                                                                                          --------->AHL25(2)
                                                                  ------------>CBF       --------->AHL25(2)
              <-------TEIL <---------AHL20(2)              --------->RVE1(2)             --------->AHL12(3)
             <------ZmHOX2a(2)                            <---------ICU4                 --------->AHL20(3)
            <---------GATA12                            --------->AHL20(3)               <---------AHL20(3)
            --------->GATA12                            --------->AHL12(3)               <---------AHL25(2)
            --------->ARR11(3)                          <---------AHL25(1)               <---------AHL12(3)
            <---------ARR11(2)           <---------ZAT14<---------AHL12(2)               <---------AHL12(2)
            <---------ARR11(3)           --------->ZAT14<---------AHL20(3)               --------->AHL25(3)
            --------->AGP1 --------->AHL20(2)          --------->YAB1                    --------->AHL12(2)
      ==============HOX2a_HOX2a          <---------ZAT18<---------AHL12(3)              --------->YAB1
      ------>ZmHOX2a(1)   --------->AHL20(2)           --------->AHL20(2)           --------->AHL20(2)
--------->RVE1(2) ---------->DOF2   <---------YAB1   <---------WOX13(2)          --------->YAB5    -
----->AtSPL8--------->ARR11(2) <---------ICU4    <---------At4g35610  --------->AtLEC2  --------->AHL12(2)
 
tactatctcctaatagatccataaaacaatttaaaaattactagtgtagtttagctaataaaaatcacttgcaatgcaagtgtttgattaaaaataattt  22825800
       <---------AHL12(2)
      <---------AHL25(3)
      --------->AHL25(1)
      <---------AHL25(1)
      --------->AHL25(2)
      <---------AHL25(2)
      <---------AHL12(3)
      --------->AHL12(3)
      <---------AHL20(2)
     --------->AHL12(3)
     <---------AHL20(2)
     --------->AHL20(2)
     <---------AHL20(1)
     --------->AHL25(1)
     <---------AHL25(1)
     <---------AHL25(3)
     --------->AHL25(3)
     --------->AHL25(2)
     <---------AHL25(2)
     <---------AHL12(1)
     --------->AHL12(1)
    <---------AHL12(2)
    --------->AHL12(2)
   <---------AHL20(3)
   <---------AHL25(2)
   --------->AHL20(3)
   --------->AHL12(2)
   --------->AHL12(3)
   --------->AHL25(2)
 --------->AHL25(3)
 <---------YAB1
----AHL20(2)
--AHL12(2)
>AHL25(2)
-AHL12(1)
-AHL25(2)                                --------->YAB1
-AHL25(3)                               <---------YAB5                                           <--
>AHL20(1)                             --------->YAB1                                             ---
>AHL12(1)                            <---------AHL20(2)                                          ---
>AHL25(1)              <---------HSFC1(2)<---------ICU4                                       <-----
-AHL25(1)              <---------HSFB2a(1)                         ----------->RAV1(1)     <--------
-AHL12(3)              --------->HSFC1(2)--------->KAN1           *TSS                     <--------
>AHL20(2)              --------->HSFB2a(1)              <---------KAN1                    <---------DOF5.7(1)
-AHL20(2) <-----------GT1           <---------AHL12(2)  <---------CCA1(2)         <-----------ARR10
-------->YAB1<----------DOF2     ----------->TBP     ------>ZmHOX2a(1)           <---------CCA1(2)
 
aagtataattttttttcttttgcagaaatttcttctatatataatcatcccatctcctcataactcacaacaacattgaaacccatttcttcgcctttaa  22825900
                        <---------DOF5.7(1)
                       <---------DOF5.7(1)
                      <----------DOF2
                      <---------DOF5.7(1)
                      ------>ZmHOX2a(1)
             <-----------RAV1(1)
 <---------ANAC58    <---------DOF5.7(1)
 <---------ANAC58 <---------PCF2
-------MYB59 <---------ANAC58
------>TOE1(3)  <---------MYB46(3)      --------->ANAC46         --------->KAN1
------>TOE2(3) --------->ALFIN1         --------->ANAC58  <---------ATHB12
------GT1    <---------ANAC46           --------->ANAC58 --------->GATA12
-DOF5.7(1)   <---------ANAC58   <----------DOF2    --------->At4g35610             ------>ZmHOX2a(1)
--DOF2 --------->AHL12(1)    <-----------GT1       <---------At4g35610            --------->TOE2(3)
 
ccttacttgaatttttgtgtgggtcctttttttttctttctccaagccattgtaagctccaatcttccacattctatctcttcttcctcattttcttcca  22826000
                        --------------->AGL15
                       <---------YAB1
                       ----------------->AGL3                                                      <
            <---------AHL12(3)                                                                    <-
            <---------AHL20(2)                 <---------ANAC58 --------->DOF5.7(1)               <-
            <---------AHL25(1)          --------->DAG2          --------->DAG2                    --
            --------->AHL12(3)         ---------->DOF2        --------->DOF5.7(1)                <--
           --------->AHL20(1)      <---------YAB5             ---------->DOF2                  -----
           --------->AHL25(3)      <---------YAB1          <---------KAN1                      -----
           <---------AHL20(1) --------->ANAC55(2)       <------ZmHOX2a(1)                     <-----
          --------->AHL12(3)<---------AHL20(2) <---------ANAC58--------->DOF5.7(1)            ------
 <-------TEIL        <-----------GT1--------->YAB1 <---------ANAC46  <------NtERF2     ----------->GT1
 
tacatacacacatatatatttctgttaccatttaagtgatcataaagttttcttgtgtaggaataaaaaggcagagaaaatggagttttttggtaaaatg  22826100
                                                                <---------WRKY38(1)
                                                                <---------WRKY12
                                                             <------MYB46(1)
    --------->WOX13(2)                                       <------MYB83
    <---------WOX13(2)                                       <---------ANAC46
   --------->ATHB12                                         <------MYB83
  <---------YAB1                                 --------->ZAT6--------->WRKY18(1)
  <---------AHL20(2)  --------->YAB1         <-------GAMYB  <---------MYB46(3)
---------WOX13(2)     --------->YAB5        <------MYB83<---------MYB46(3)
--------ICU4         <---------YAB1         <------MYB46(1) --------->MYB59
--------AHL12(1)   --------->YAB5           ----------->GT1 <------MYB46(1)
------->AHL12(1)   --------->YAB1           --------->YAB5<--------P          --------->KAN1
-------YAB1       --------->ICU4            <---------MYB46(3)<-----------HVH21                    <
---->YAB1         <---------YAB1       --------->ALFIN1 --------->ATHB12 --------->ANAC58   --------
---->YAB5       --------->YAB1       <---------ANAC58   --------->MYB55(2)  ----------->RAV1(1)    <
----YAB1        --------->YAB5       <---------ANAC58  <---------YAB5    --------->ANAC46   <-------
----->GT1      <---------YAB1        <---------ANAC46  <---------AtMYB61 --------->ANAC58 <------ZmHOX2a(1)
 
ataatttcattgagtcttatgatgatgataatgtggaagagcgtggatggttacagtagtggttgggtcaatgctcgagccacattctatggaggagctg  22826200
        <------NtERF2
       ------>NtERF2
   <---------HSFB2a(2)            ----------->HVH21
   --------->HSFB2a(2)  --------->KAN1
 ----------->RAV1(2)  <---------ANAC58               --------->YAB5
---------ANAC58       <---------ANAC58       ----------->GT1   <-----------GT1
->At4g35610      --------->WOX13(2)     <---------DAG2    <---------YAB1
---------ANAC58  <---------WOX13(2)     <----------DOF2<---------YAB1
--At4g35610  ----------->GT1  ------>ZmHOX2a(1)     <---------YAB1----------->HVH21               <-
 
atgcttctggcaccatgggtaatttgcttactcctctctgacactttatagttatatcattcttattttctgaccaatataacttcaaacttcaaatttc  22826300
                                                  <---------AHL25(1)
                                                  <---------AHL12(1)
                                                  <---------AHL20(2)
                                                  --------->AHL25(1)
                                                  <---------AHL25(3)
                                                  --------->AHL12(1)
                                                  --------->AHL20(2)
                                                 --------->AHL20(2)
                                    <---------AHL12(3)
                                    <---------AHL25(3)
                                    <---------AHL20(3)
                                   --------->AHL25(1)
                                   --------->AHL20(2)
                                 --------->AHL12(2)<---------AHL20(3)
                                 --------->WOX13(2)<---------AHL12(3)
                          <---------MYB46(3)    <---------WOX13(2)
              <---------YAB1----------->HVH21   --------->WOX13(2)
        <---------TOE2(3) ----------->GT1      <---------ICU4
        <---------TOE1(3)--------->ALFIN1     --------->ICU4                --------->ANAC46
       ---------->DOF2--------->ATHB12--------->KAN1                   ------->TEIL             <---
<------ZmHOX2a(1)    <---------YAB5<---------AHL20(2)--------->KAN1    --------->ARR11(2)    <------
--------TOE1(2)  <---------YAB1  <---------WOX13(2)<---------AHL25(3) <---------CCA1(2)<---------YAB1
 
ttaggaattttaaagtttttattagtgagtggtgacaattaatatgctactaattaatatgctacataagtttgtatctacacaagtcttatttttgtgt  22826400
<- Previous    Next ->

AGI:  At5g56320.1   
Description:  ATEXPA14 (ARABIDOPSIS THALIANA EXPANSIN A14). Identical to Expansin-A14 precursor (EXPA14) [Arabidopsis Thaliana] (GB:Q9FMA0;GB:Q0WLD1;GB:Q8L9W7); similar to ATEXPA15 (ARABIDOPSIS THALIANA EXPANSIN A15) [Arabidopsis thaliana] (TAIR:AT2G03090.1); similar to expansin [Pyrus pyrifolia] (GB:ABQ45887.1); contains InterPro domain Expansin 45, endoglucanase-like (InterPro:IPR007112); contains InterPro domain Rare lipoprotein A (InterPro:IPR005132); contains InterPro domain Expansin/Lol pI; (InterPro:IPR007118); contains InterPro domain Expansin; (InterPro:IPR002963); contains InterPro domain Pollen allergen/expansin, C-terminal (InterPro:IPR007117)
Range:  from: 22825867    to: 22827463    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version