AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                           <---------YAB1
                                                                        <---------YAB5
                                                                        <---------YAB1
                                                                       <---------WOX13(2)
                                                                       --------->WOX13(2)
                            <---------ICU4                           --------->AHL20(2)
                            --------->YAB1                           <---------YAB1
                           --------->ICU4                            <---------AHL20(2)
                          --------->AHL20(1)                        --------->AHL25(1)
                          <---------AHL12(2)                        <---------AHL12(3)
                          <---------AHL25(2)                        --------->AHL12(3)
                          --------->AHL20(3)                        <---------AHL25(2)
                          --------->AHL25(2)                        <---------AHL25(1)
                  <----------ID1                                    --------->AHL25(3)
                --------->DOF5.7(1)               <---------KAN1    <---------AHL20(2)
       --------->TOE1(3)  <---------AHL20(3)     --------->GLK1(2)  --------->AHL25(2)
    <-----------GT1      --------->AHL12(2)  --------->YAB1         --------->AHL20(2)
----->GAMYB     --------->DAG2         --------------->AGL15       --------->AHL12(2)
---->P --------->TOE2(3) --------->YAB1<---------------AGL15       --------->YAB1
----KAN1       ---------->DOF2         --------->TOE1(3) --------->ANAC58<---------ICU4
--->MYB46(3)   --------->DOF5.7(1)     --------->TOE2(3) --------->ANAC58--------->YAB1
 
accctatataccttaagaaaaagcacaaaaataatgaagaaaccctaataagaatttgaaacggaaggaattttaattataactagtagaactatataag  22354500
                                --------->ZAT6
                           --------->WOX13(2)
                          <---------WOX13(2)
                          --------->WOX13(2)
                        --------->AHL25(1)
                        <---------AHL12(3)
                        --------->AHL20(3)
                        <---------AHL25(1)
                        <---------AHL25(3)
                        --------->AHL25(3)
                    <---------AHL12(2)
                    <---------AHL12(3)
                    --------->AHL25(2)
                    --------->AHL12(3)
                   <---------AHL20(1)
                   <---------AHL20(2)
                   --------->AHL12(3)
                   --------->AHL12(1)
                   --------->AHL20(1)
                   <---------AHL12(1)
                   --------->AHL20(2)
                   --------->AHL25(2)
                   <---------AHL12(3)
                   --------->AHL25(3)
                   <---------AHL25(3)
                   <---------AHL25(2)
                   <---------AHL25(1)
                   --------->AHL25(1)
                  --------->AHL20(2)                                                             <--
                  <---------AHL12(3)                                                             ---
                  --------->AHL12(3)                                                             ---
                  <---------AHL20(2)                                                             <--
                  --------->AHL25(1)                                                             ---
                  <---------AHL12(1)                                                             <--
                  --------->AHL25(3)                                                             ---
                  --------->AHL12(1)                                                             <--
                  <---------AHL25(1)                                                             <--
             <---------MYB59--------->AHL20(2)                                <---------MYB52(1) ---
             --------->TOE2(3)<-----------GT1                                 <----------DOF2    <--
           -------->P<---------AHL12(2)  <---------AHL20(2)                  <---------DOF5.7(1) ---
        <---------ANAC58--------->AHL20(2)      --------->ZAT14        <<<<<<<<<MYB2           -----
        <---------ANAC58<---------AHL20(2)      <---------ZAT14        <------------------------ANAC81
      <-----------GT1<---------WOX13(2) --------->AHL20(2)       <----------DOF2     <---------ANAC58
      <---------AHL20(2)--------->AHL12(3)     <---------ZAT6   <---------DOF5.7(1)  <---------ANAC58
 
tttctatatttacttacctaaataaatttaaataaacactacaataaatagtgtagaaactctctactcttttggttttccctttgtttcgtttctatat  22354600
            <---------WOX13(2)
          <-------TEIL
  <---------AHL20(2)
--------->AHL12(2)
-------AHL25(3)
------>AHL25(3)
------>AHL12(3)
-------AHL20(2)
------>AHL20(2)
-------AHL20(1)
------>AHL20(3)                         --------->MYB52(1)                   --------->At5g28300
-------AHL25(2)                     <-----------ARR10                       ----------->GT1
-------AHL20(3)                     <---------GATA12                  --------->DOF5.7(1)
------>AHL25(2)                     --------->GATA12                ---------->DOF2
-------AHL25(1)                     --------->RVE1(2)           --------->ANAC58
------>AHL25(1)              ----------->GT1                    --------->ANAC58
---->AHL12(2)               <---------------AtSPL8        <---------------AGL15                    -
 
tttattttttgagttcattagaaatacaaaaatggttcaaatctaacggtgctacaaatttcttcacaaggaaaagacactgtaacaaaattgaaattgc  22354700
                                                                                                   <
                                                                                                <---
                                                                        --------->At4g35610    <----
                                                                        <---------KAN1         -----
                                               ------>ZmHOX2a(2)       --------->ARR11(2)      <----
                                              --------->At4g35610      --------->ARR14(2)      <----
             --------->DOF5.7(1)             <---------ARR11(3)        <---------ARR14(2)      <----
          <------ZmHOX2a(1)                  --------->ARR11(3)        --------->GLK1(2)       -----
         --------->ANAC58                  <---------YAB1              <---------GATA12       ------
         --------->ANAC58                  <---------YAB5              <-----------ARR10      ------
        <---------TOE2(2)                --------->YAB1           ---------->DOF2             <-----
        <---------TOE1(2)                --------->YAB5       ----------->RAV1(1)          <--------
       <-----------RAV1(2)               <---------ICU4      <----------ID1                ---------
   <-----------HVH21                    <---------YAB5     --------->YAB5                  ---------
  ------->GAMYB                         <---------ATHB12   --------->YAB1                  ---------
-------->MYB52(1)--------->TOE2(3)     ------->TEIL ----------->HVH21 <---------GLK1(2)    ---------
 
cataacagtcgcaggaaaaaccatagtactactagtaacatgaatcatgatctgtctgacaatgacaacaaaagaatctgcctatagacttcatttatat  22354800
                                         <---------AHL25(3)
                                         <---------AHL25(2)
                                         <---------AHL12(2)
                                         --------->AHL25(2)
                                         <---------AHL20(3)
                                         --------->AHL20(3)
                                         --------->AHL12(2)
                                        --------->AHL20(2)
                                        <---------AHL20(2)
                                        --------->AHL12(3)
                                        --------->AHL25(2)
                                        <---------AHL12(3)
                                        --------->AHL12(1)
                                        <---------AHL12(1)
                                        <---------AHL25(3)
                                        --------->AHL25(3)
                                        --------->AHL25(1)
     <----------DOF2                    <---------AHL25(1)
    <---------DOF5.7(1)                <---------AHL20(2)
   ------>ZmHOX2a(1)                   --------->AHL12(1)
<-----------GT1                        <---------AHL25(2)
-----------GT1                         --------->AHL25(3)
------AHL12(2)                         --------->AHL25(2)
-----AHL12(1)                          --------->AHL25(1)
---->AHL12(1)                          <---------AHL12(1)
-----AHL20(2)                          --------->AHL12(3)
-----AHL25(1)                          <---------AHL12(3)
-----AHL12(3)                          <---------AHL25(1)
---->AHL12(3)                         --------->AHL12(3)
--->AHL25(3)                          --------->AHL25(2)
--->AHL20(1)                          <---------AHL12(2)
----AHL20(1)                 <----------DOF2  --------->YAB1
-AHL20(2)             <----------DOF2 <---------AHL12(3)  --------->TOE1(3)
>AHL20(2)            <---------DOF5.7(1)<---------AHL25(2)--------->TOE2(3)               --------->AtMYB61
>AHL20(3)       <---------YAB1        <---------AHL25(2) <----------ID1                <-----------GT1
>AHL12(3)       <---------YAB5       <---------ICU4 --------->YAB1<-----------GT1      --------->ANAC46
>AHL25(1)<-----------GT1--------->KAN1--------->AHL12(2) ----------->GT1           ----------->TBP <
 
attttcctcttttcacattatcagtctttattctttttaaaaattattttcatacttataacgtcaaattcacatttcttctctctatataaaccacact  22354900
                                                                                       <---------ARR11(2)
                                                     <------NtERF2                --------->ANAC46
                                                    --------->LBD16          <---------KAN1
                                                   --------->LBD16      <------NtERF2  --------->ARR14(2)
                                           --------->DAG2              ------>NtERF2   <---------MYB52(1)
                                          ---------->DOF2             --------->DEAR3(1)   ------>ZmHOX2a(1)
    --------->GATA12         <---------LBD16--------->KAN1           --------->DEAR3(2)--------->ARR11(2)
 <-----------GT1          *TSS     --------->KAN1 <---------LBD16--------->KAN1 <---------ALFIN1
----------DOF2    --------->RVE1(2)<---------HSFB2a(1)          <-----------------------TaNAC69(2)
 
aactttacatctctcttacaaactccaagagcctcggagcattcgaaaagttcgccggaaaaacaaaaacatgccgacgaacaacactccgttcctcact  22355000
                                                                                                   <
                                                                                                   -
                                                                                                   <
                                                                                                   <
                                                                                        <---------ANAC55(2)
                                                                                        <---------ANAC55(1)
                                                                --------->WOX13(2)      <---------ANAC58
                                                           --------->LBD16              --------->ANAC55(2)
                                         --------->LBD16  ------->GAMYB                 <---------ANAC58
                                        --------->LBD16   <---------LBD16             <-----------GT1
           <---------ANAC58            --------------->AGL15--------->LBD16         <---------KAN1 -
           <---------ANAC58            <---------LBD16   <---------LBD16         <------ZmHOX2a(1) <
        <----------DOF2         <---------YAB5          -------->P             --------->LBD16    <-
       <---------DOF5.7(1)<---------ARR11(2)      --------->At4g35610         <---------HSFB2a(2) --
      ------>ZmHOX2a(1)   --------->ARR11(2)      <---------At4g35610         --------->HSFB2a(2) <-
  <-----------GT1     <---------LBD16 <---------LBD16 ----------->HVH21       <---------LBD16     --
<-----------GT1   --------->KAN1<-------TEIL      --------->ZAT2<---------WOX13(2)  --------->KAN1--
 
atttttctcctctttcttggtttactccggttcgattcatttcccggtttagaagctgcaaccgggaaattagcttcgattccaggattatacgtgttcg  22355100
                              <---------ANAC55(2)
                            <---------AHL20(2)
                            --------->AHL20(2)
                            <-----------GT1
                          --------->AHL12(2)
                --------->LBD16
                <---------RAP2.6(3)
                --------->ANAC46
                --------->ANAC58
                --------->ANAC58<-----------GT1
       <-------GAMYB      <---------AHL12(2)
       <---------WOX13(2)<--------HAHB4
      --------->MYB55(2) --------->ATHB51
      <---------MYB46(3) <---------ICU4
      --------->MYB46(2) <--------ATHB1
      --------->MYB52(2) --------->YAB5
    <---------MYB52(1)   --------->YAB1
   --------->TOE2(3)    --------->AHL20(2)                               ------>NtERF2             -
 <-------TEIL <---------LBD16 <---------ANAC58                          --------->DEAR3(1)        <-
--------->ARR14(1)      <---------ATHB51                                <---------DEAR3(1)       ---
--------->GLK1(2)       --------->ICU4                     <-----------GT1                       ---
---------GLK1(2)------>NtERF2 --------->ANAC55(2)          --------->RVE1(2)                     ---
-------->GATA12<---------ATERF1(2)                       <---------YAB5 <---------ANAC46         ---
---------ARR14(2)       <---------ATHB12                --------->AHL12(2)     <---------KAN1   ----
---------ARR11(2)       --------->AHL25(3)              <---------WOX13(2)   <---------RVE1(2) -----
-------->ARR14(2)     --------->YAB1                    --------->WOX13(2) ----------->ARR10   <----
---------GATA12--------->ATERF1(2)                      <---------AHL12(2)<------NtERF2  --------->ANAC46
--------HSFB2a(1)  ----------->RAV1(1)           ---------->DOF2      ------->GAMYB      --------->ANAC58
------->HSFB2a(1)<------NtERF2<---------ANAC58 >>>>>>>>>RAP2.2      --------->RAP2.6(3)  --------->ANAC58
--------GLK1(1)<---------RAP2.6(2)           --------->ARR11(3)    --------->MYB52(1)  <---------KAN1
------->GLK1(1)--------->RAP2.6(2)           <---------ARR11(3)   ----------->HVH21 --------->LBD16<
------->KAN1  --------->RAP2.6(3)-------->P  --------->RVE1(2)  --------->ANAC46<-----------GT1<----
 
gagattcgttagttgatgccggcaacaataattacttaccaatttcaatatctaaagctaattatccacataacggcgtcgattttccgaacaagaaacc  22355200
                                                          <---------YAB1
                                                        --------->ATHB51
                                                        --------->YAB1
                                                        <--------HAHB4
                                                        -------->HAHB4
                                                        <---------AHL20(2)
                           --------->ABI4(1)            -------->ATHB1
                           ------>NtERF2                --------->ATHB12
      --------->GLK1(2)    <---------ATERF1(1)          <---------ICU4
     <---------ARR14(2)    --------->LBD16              <---------AHL25(3)
     <---------GLK1(2)    --------->DEAR3(1)           <---------YAB5
     --------->ARR11(3)   --------->RAP2.3(2)          <---------ATHB51
     --------->ARR14(2)   <---------DEAR3(1)           --------->ICU4
    --------->HSFB2a(1)   --------->RAP2.3(3)          <---------YAB1
    <---------HSFC1(2)   --------->DEAR4(2)            --------->AHL25(3)
    --------->HSFC1(2)   --------->RRTF1(1)           --------->AHL12(2)
    <---------HSFB2a(1)  --------->ATERF1(1)          <---------WOX13(2)
    --------->KAN1       --------->ORA47(2)           <---------AHL12(2)
   ----------->ARR10     --------->ERF1               --------->WOX13(2)
--------->LBD16          --------->RAP2.3(1)         --------->YAB1
-------->HSFB2a(2)      <---------ATERF1(1)          <---------ICU4--------->LBD16
--------LBD16          --------->ANAC58             <---------AHL25(1)
--->MYB46(1)           --------->ANAC46             --------->AHL25(1)
------>MYB52(1)        --------->ANAC58             --------->AHL25(3)
----->P      --------->RAP2.6(3)                    --------->AHL12(1)
--->MYB83   --------->MYB52(1)                      --------->AHL20(2)
----->MYB55(1)     --------->ANAC58                 <---------AHL20(2)        <---------AHL20(2)
---->AtMYB61--------->ARR11(2)                      <---------AHL12(1)      --------->AHL12(3)
-----MYB59 ----------->HVH21 --------->DEAR3(1)   <---------WOX13(2)        --------->AHL12(2)
---------HSFB2a(2) --------->ANAC58               --------->WOX13(2)  <-----------HVH21
-----MYB111(1) ------->GAMYB<------NtERF2       <---------YAB1   <---------LBD16<-----------GT1-----
 
taccggaagattctgtaacggcaagaacgccgccgatgctatcggtgagtttttattaattattagtctccggtgtcatattttttctgtatgaaatgaa  22355300
                                                                                <---------AHL20(3)
                                                                                --------->AHL25(2)
                                                                                --------->AHL20(3)
                                                                                <---------AHL20(1)
                                                                                <---------AHL12(1)
                                                                                --------->AHL20(1)
                                                                                --------->ARR11(3)
                                                                                <---------ARR11(3)
                                                                                <---------AHL12(2)
                                                                                --------->AHL12(1)
                                                                                <---------AHL25(3)
                                                                                <---------AHL25(2)
                                                                               --------->AHL25(1)
                                                                               --------->AHL12(3)
                                                                               <---------AHL25(1)
                                                                               <---------AHL20(2)
                                                                               <---------AHL12(3)
                                                                               <---------AHL12(1)
                                                                               --------->AHL12(1)
                                                                               --------->AHL25(3)
                                                                              --------->AHL25(3)
                                                                             --------->AHL12(2)
                                                                             <---------AHL12(2)
                                                                           --------->AHL25(3)
                                                                           <---------AHL25(3)
                                                                           --------->AHL25(2)
                                                                           <---------AHL20(2)
                                                                           <---------AHL12(1)
                                                                           --------->AHL20(2)
                                                                           <---------AHL25(1)
                                                                           --------->AHL12(1)
                                                              ------>NtERF2--------->AHL12(3)
                                                            <---------ANAC58<---------AHL20(2)
          <---------ZAT6           <------MYB83             <---------ANAC58<---------AHL25(3)
        <------MYB46(1)            <------MYB46(1)      --------->KAN1     --------->AHL25(1)
        <------MYB83           --------->ATHB12    ----------->GT1         <---------AHL12(3)
      <--------P              <---------YAB1       <---------ANAC58   --------->AHL12(2)
    <---------ZAT6       <---------ATERF1(1)       <---------ANAC55(2)<---------AHL12(2)
    <-----------RAV1(1)  --------->ANAC46          <---------ANAC58  --------->YAB1
<---------YAB1           --------->ANAC58      <---------RVE1(2)    --------->AHL20(2)   --------->YAB1
-->TEIL<---------AtMYB61 --------->ANAC58<---------RVE1(2) --------->ZAT2<---------AHL12(2)
 
actattagtgttggtgttatgttatggcaggccacgattggtttgatttagatagcgtaacatgctggccattaaaaattaaatattttcactcatatat  22355400
<- Previous    Next ->

AGI:  At5g55050.1   
Description:  GDSL-motif lipase/hydrolase family protein. similar to GDSL-motif lipase/hydrolase family protein [Arabidopsis thaliana] (TAIR:AT5G37690.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN78085.1); contains InterPro domain Lipase, GDSL, active site; (InterPro:IPR008265); contains InterPro domain Lipase, GDSL; (InterPro:IPR001087)
Range:  from: 22354927    to: 22357326    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version