AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                    <---------CCA1(2)
                                <---------At4g35610
                                --------->ANAC55(2)
                                <---------TGA1a
                                <---------ANAC55(2)
                             ----------->HVH21
                 <----------DOF2--------->O2
                <---------ANAC58<---------O2
           --------->ZAT2    <---------MYB52(1)
           --------->At4g35610  ==================================bZIP_DOF
           ----------->RAV1(2)  =========================bZIP_DOF
           <---------ZAT2   <-----------HVH21     <---------ANAC58                                 -
   <---------At4g35610      <-----------TGA1  <----------DOF2                                    <--
 <---------RAP2.6(2)       --------->ANAC46  <---------DOF5.7(1)                                 <--
--------->RAP2.6(3)      ------>ZmHOX2a(1)  ------>ZmHOX2a(1)                                 <-----
-------->MYB52(1)=========================bZIP_DOF<---------ANAC58                           <------
--------DOF2    <---------ANAC58----------->RAV1(2)    ---------->DOF2                  ------>ZmHOX2a(1)
-------DAG2<---------At4g35610  --------->At4g35610<----------DOF2          ---------->ARF1  <------
 
ctttacggctgatcagctggctttcatcctccgtcacctgtctcttcctctttgcttttaaagaaatagtcttcttgttgtctcccaagtcctcatgctt  20818200
        --------->ALFIN1
  <---------------AGL15
  --------------->AGL15                                   --------->YAB1
  <----------DOF2                                  ------>NtERF2
 <-----------------AGL3                         <---------At4g35610
----->ZmHOX2a(1)                       <---------TOE1(2)<-----------HVH21                          <
-------ANAC58                       --------->TOE1(1)<---------ANAC58        <---------AtLEC2    <--
-------ANAC58                 <---------ANAC58  --------->ZAT2          --------->At4g35610      <--
-----DOF2                 <----------DOF2    ---------->DOF2            <---------ZAT2    ----------
---ANAC58         <---------TOE2(3)------>ZmHOX2a(1) <---------ANAC58   --------->ZAT2<-----------HVH21
---ANAC58    ----------->GT1  <---------ANAC58  --------->At4g35610     <---------At4g35610     <---
 
tcctgcttcaagtgggaagttaagaatagctttgcttcctcgtagtttaaaagctgccttgtcataacctcttgcagcttccatggctgtgtcaaaagtg  20818300
                                            --------->LBD16
                   <---------ANAC58        --------->RAP2.3(2)
                <----------DOF2            --------->RAP2.6(2)           ------>NtERF2
        --------->ANAC58                 --------->At4g35610            --------->ANAC58      ------
   --------->ANAC46<---------ANAC58      --------->ZAT2                 --------->ANAC58     <------
-------->P     <---------DAG2        ------>ZmHOX2a(2)               ----------->TGA1        -------
---------ARR11(2)  <-----------------AGL1<---------At4g35610<---------ARR11(3)               -------
-------MYB46(2)<---------DOF5.7(1) --------->GATA12  --------->ANAC46------>ZmHOX2a(1)      <-------
-------MYB59<---------ALFIN1       <---------GATA12<-----------GT1   ----------->HVH21      <-------
>DOF2   --------->ANAC58     <---------GLK1(1) <---------KAN1      <---------At4g35610    --------->YAB1
--------------------TaNAC69(2)     <-----------ARR10-------->P     ----------->RAV1(2) <----------DOF2
 
cctaaccagacacgaacacctttcttgtttgggtctctgatctcagccgcatacttaccccatggtcttctcctgacgcctctgtaatgcctttgatcat  20818400
                                                                                       <---------MYB46(3)
                                                                                   <---------MYB46(3)
                                                                                   --------->MYB55(2)
                                                                                  <---------ANAC46
                                                                                <---------MYB46(3)
                                                          <---------ANAC58     --------->ALFIN1
                                                          <---------ANAC58     <---------AtMYB61
                                                          <---------ANAC46 --------->ZAT14
                                                      <---------MYB52(1)   --------->ZAT18
                        --------->ARR14(2)           <-------GAMYB         <---------ZAT14
     <---------MYB55(2) <---------ARR11(2)          <---------ANAC46    <---------MYB46(3)        --
     --------->MYB46(3) <---------ARR14(2)          <---------ANAC58   <---------AtMYB61        ----
--->KAN4(2)  <---------ZAT14                        <---------ANAC58   --------->ALFIN1<------MYB46(1)
---ICU4      <---------ZAT18                    <---------ANAC58       <---------DEAR3(1)--------->ALFIN1
-->YAB5      --------->ZAT14                    <---------ANAC58    <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
-->KAN1--------->MYB52(1)     <----------DOF2 <---------MYB46(3)    <---------AtMYB61  <------MYB83
--YAB1--------->AtMYB61 --------->ARR11(2)   --------->ALFIN1       <---------TOE2(3) <---------AtMYB61
--YAB5<---------ALFIN1 <------ZmHOX2a(1)     <---------AtMYB61 <---------ZAT6<---------ANAC46 <-----
 
tctcttgaaccaccggtgcagtagtaggaactgctatagtggcaagaggtggtttgcgttggcttagagttgaggtggtgcagtggtggatggtggaggc  20818500
                                                     ----------->HVH21
                                             --------->CCA1(2)
                                             <------ZmHOX2a(2)
                                            --------->GATA12
                                            --------->AGP1
                                            <---------GATA12
                                            <---------ARR11(3)
                --------->GLK1(1)           --------->ARR11(3)
                <---------GLK1(1)       <---------YAB1
         <------ZmHOX2a(1)         <------MYB46(1) <---------At4g35610                   --------->ANAC58
------->DOF5.7(1)  --------->YAB5  <------MYB83 ---------->DOF2            <---------MYB46(3)
------>DOF2 ----------->GT1      <---------ANAC46  --------->At4g35610   <-------GAMYB   --------->ANAC58
-NtERF2<---------TOE2(3)      --------->ALFIN1------>ZmHOX2a(2)         <-----------RAV1(1)        -
 
aaaggtgtctaaggaagggaaatcagtaagaaggtgttgggttatgagatctaaagctgactggtcttgttcttgctgttgttgatgtgaagaagccata  20818600
                                                                                                ----
                                         *TSS                                   <------------CBF----
                                  <---------YAB1                         --------->DOF5.7(1)    <---
                                 <---------RVE1(2)                <-----------TBP           <-------
        <---------YAB1   ---------->ID1 <---------RVE1(2)    ----------->GT1--------->ALFIN1<-------
        <-----------RAV1(1)    <---------YAB1        <---------TOE2(3)   --------->DAG2     <-------
 <---------YAB1          <---------TOE2(3)           <---------RVE1(2)<---------AHL20(2) <---------ARR14(2)
-------->YAB5        <----------DOF2 <---------TOE2(3) <------------CBF ---------->DOF2  <---------ARR11(2)
 
gatgatgaattatgttggagtcttctttgtggttttgattatggattttggtttttgagattggaggttatatataaaagtgggattgagaggtttcgta  20818700
                                   <------------CBF
                                ------------>CBF
                             ------>ZmHOX2a(1)
                             <----------DOF2
                            <---------DOF5.7(1)
                          <------ZmHOX2a(2)
                         <---------ARR11(2)
                         --------->ARR14(2)
                         <---------ARR11(3)
                         --------->ARR11(2)
                         <---------ARR14(2)
                         --------->ARR11(3)                              --------->ALFIN1
                       <---------HSFC1(2)                                <---------KAN1
                       --------->HSFB2a(1)                             <---------ANAC58
 <---------GLK1(2)     <---------HSFB2a(1)                             <---------ANAC46
----->STY1(2)       <------ZmHOX2a(1)                                  <---------ANAC58       <-----
----->ZAT2  <------MYB46(1)------>ZmHOX2a(2)                      <----------DOF2       <---------ZAT14
------STY1(2)       ==============HOX2a_HOX2a                    <---------ANAC58  --------->ZAT14 -
--ANAC46    <------MYB83<------ZmHOX2a(1)                   <-----------RAV1(1)    <---------ZAT14--
--ANAC58  <--------P=============HOX2a_HOX2a <---------ANAC58    <---------ANAC46  --------->ZAT18--
--ANAC58 <-------GAMYB --------->HSFC1(2)    <---------ANAC58    <---------ANAC58  <---------ZAT18<-
 
gctagcttcttgggttggagagaggaaggatccttttcaattgttttgacttgtttagttctattgttgctttggagtgtggcaagtggactactctatc  20818800
           <---------ARR11(3)
           <---------RVE1(2)
           --------->ARR11(3)
         <---------YAB1
         <---------TOE1(3)
         <---------TOE2(3)
      <---------AHL20(2)
    <---------YAB1
   --------->AHL20(3)
   <---------AHL25(2)
   --------->AHL25(2)
   <---------AHL20(3)                                      --------->YAB1
   <---------AHL20(2)                                      <---------ICU4
  --------->AHL12(1)      ---------->ID1                --------->YAB1
 <---------YAB1       <---------GLK1(1)              --------->WOX13(1)                         ----
<---------AHL12(2)    <---------KAN1         <---------ANAC58                              ---------
--------->AHL12(2)   <---------ARR14(2)      <---------ANAC58                              <--------
----ATHB12--------->YAB1<-----------RAV1(1)  <---------ANAC46                              <--------
-------->YAB1 <---------WOX13(2)         <---------ANAC58 <---------YAB1                   ---------
------->AHL25(3)     --------->ARR14(2)  <---------ANAC58 <---------YAB5                   ---------
------->AHL20(2)    <------ZmHOX2a(1)<---------DOF5.7(1)<---------ICU4                    --------->KAN1
--------AHL20(2)  <---------TOE2(3) <----------DOF2 <-------TEIL<---------RVE1(2)         <---------CCA1(2)
 
atttattattttaagataatgaaggatttgtggctatgtctttttcttgcgagggtccatcatcatagctattgtctatttccaggcttcttcatatccc  20818900
       <---------AHL25(3)                                                                          <
      <---------AHL25(3)                                                                           <
      <---------AHL20(2)                                    --------------->AGL15                <--
      --------->AHL20(2)                                    <---------------AGL15               ----
    --------->WOX13(2)                 --------->AHL12(1)   <----------DOF2                  -------
    <---------WOX13(2)           ---------->DOF2           <-----------------AGL2--------->AHL25(2)-
----->ANAC46               <---------RVE1(1)               <-----------------AGL1<---------AHL25(2)-
>ARR11(2)                  <---------CCA1(1)         <-----------GT1         ----------->GT1 -------
-ARR11(2)                  --------->KAN1         <---------DOF5.7(1)  --------->DAG2       --------
-ARR14(2)                 --------->ARR11(3)     <---------DAG2  <---------TOE2(3)          --------
>RVE1(2)                  <---------RVE1(2)      <----------DOF2 <---------TOE1(3)--------->AHL12(2)
>ARR14(2)                 <---------ARR11(3)     <---------DOF5.7(1)  ---------->DOF2      ---------
 
agacacaaattaaaaatgtttttctgagagatatttgaaagaaaaattgacacttttttcttacttttaagggtaaagtttagttatattttggaaaagg  20819000
    --------->ANAC58
    --------->ANAC58                                             <-----------------AGL1
---------GATA12                                               <---------GLK1(2)
---------ARR11(2)                                             --------->ARR11(2)
-------MYB46(3)                                               --------->ARR14(2)
----->ALFIN1                                                  <---------ARR14(2)
-->DAG2                                                       <---------RVE1(2)
-------->ARR11(2)                                             --------->GATA12         <---------KAN1
-------->GATA12                                          <---------ANAC58    <---------ALFIN1
-->DOF5.7(1)       <---------ZAT18                       <---------ANAC46   <---------ZAT14
->DAG2  <---------KAN1--------->O2                       <---------ANAC58   --------->ZAT18  <------
->DOF5.7(1)  ------->TEIL        ------->TEIL          ------>NtERF2      --------->ZAT18   --------
->DOF2 ------->TEIL--------->ZAT18                  <---------At4g35610   <---------ZAT18  <--------
 
tggatgcacgaatgtgtatgtgtccacttgactatgtgcctatgttagatggtattgctgccttggattctcgtttgggcacactgtggattatatgatt  20819100
<- Previous    Next ->

AGI:  At5g51190.1   
Description:  AP2 domain-containing transcription factor, putative. Identical to Ethylene-responsive transcription factor ERF105 (ERF105) [Arabidopsis Thaliana] (GB:Q8VY90;GB:Q8LD04;GB:Q9LU55); similar to ethylene-responsive element-binding family protein [Arabidopsis thaliana] (TAIR:AT5G61600.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO62366.1); contains InterPro domain DNA-binding, integrase-type; (InterPro:IPR016177); contains InterPro domain Pathogenesis-related transcriptional factor and ERF, DNA-binding; (InterPro:IPR001471)
Range:  from: 20817810    to: 20818642    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version