AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                --------->AHL12(3)
                                <---------AHL20(2)
                                --------->AHL20(2)
                                <---------AHL12(3)
                                --------->AHL25(2)
                                --------->AHL20(3)
                                <---------AHL25(3)
                                --------->AHL25(1)
                                <---------AHL20(3)
                               <---------AHL25(1)
                               --------->AHL25(1)
                               --------->AHL25(2)
                               --------->AHL12(3)
                               <---------AHL20(1)
                               --------->AHL20(2)
                               <---------AHL20(2)
                               <---------AHL25(3)
             <---------ALFIN1  <---------AHL25(2)
          --------->YAB1       <---------AHL12(1)
         --------->MYB46(3)    --------->AHL25(3)
         <---------ATHB12      --------->AHL12(1)
    --------->ANAC58          --------->ICU4                                            <---------WOX13(1)
    --------->ANAC58          --------->AHL12(2)                                     --------->LBD16
    --------->ANAC46         --------->AHL12(2)                                    <---------LBD16
--------ANAC46           ----------->GT1                                          --------->MYB52(1)
--------ANAC58          <---------TOE2(3)                  <----------DOF2 ----------->GT1        --
--------ANAC58     --------->KAN1                         <---------DOF5.7(1)   --------->DOF5.7(1)<
----P  --------->WOX13(1)--------->ANAC55(2)        --------->GLK1(2)      ------>ZmHOX2a(1)  <-----
 
agcttgtaagcaatcaccacatatattcaggtaatttttttagcataggtagaacaatctgtctttgcatacaacatcctgtaaaaaccggattgctact  10695100
                                                               --------->LBD16
                                                           <---------GATA12
                                                           --------->GATA12
                                                           --------->ARR11(2)
                                                           <---------ARR11(2)
                                                      <-------MYC3
                                                      ------->MYC3
                                                     <---------TGA1a                            ----
                                                     --------->TGA1a                            ----
                                                     ========================================MYC_MYB
                                                    <-------MYC3                               -----
                                                    ------->MYC3--------->ANAC46     ------->GAMYB
                                                   --------->TGA1a <---------ALFIN1  xxxxxxxxxxxxxxx
                                                   <---------TGA1a<---------KAN1    --------->ANAC58
                              ---------->DOF2      ==========================================MYC_MYB
                              =================================bZIP_DOF             --------->ANAC58
                              =================================bZIP_DOF             <xxxxxxxxxxxxxxx
                           <---------HSFB2a(2)--------->ZAT14<---------LBD16<---------ICU4    <-----
                           --------->HSFB2a(2)<---------ZAT18------>ZmHOX2a(2)      xxxxxxxxxxxxxxxx
                       <---------SPL7(1)   ==================bZIP_DOF      --------->ICU4  <--------
                =============================================bZIP_DOF      <---------YAB5  ---------
 ------>ZmHOX2a(1)   --------------->AtSPL8---------->DOF2 <---------RVE1(2)--------->ATHB12 -------
---->ZmHOX2a(1) =============================================bZIP_DOF      <---------YAB1--------->LBD16
---------DOF5.7(1)   --------------->AtSPL3==================bZIP_DOF    --------->YAB1 <xxxxxxxxxxx
----ALFIN1      <----------DOF2         <---------ALFIN1  --------->KAN1 --------->REM1(1)----------
 
cctccttcttctatttagtcttttatcgtaccagaaagttgcaccacaatgcacacatgtgtgatccgcatcaccttcatcattgtaacgcccgtgaacc  10695200
 --------->RVE1(2)                                                                     <xxxxxxxxxxxx
 --------->ARR11(3)                                                                xxxxxxxxxxxxxxxx>smallRNA(i)
 <---------GATA12                                                                  xxxxxxxxxxxxxxxxx
 <---------ARR14(2)                                                               <xxxxxxxxxxxxxxxxx
 --------->GATA12                                                                 xxxxxxxxxxxxxxxxxx
 --------->ARR14(2)                                                             <xxxxxxxxxxxxxxxxxxx
 --------->GLK1(2)                                                              xxxxxxxxxxxxxxxxxxxx
 <---------ARR11(3)                                                             <xxxxxxxxxxxxxxxxxxx
----->LBD16         <---------AHL20(2)      <---------ANAC46                    xxxxxxxxxxxxxxxxxxxx
------->GT1 <---------GLK1(1)               ----------->GT1                <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
------>GT1  <---------KAN1                  <------MYB46(1)                xxxxxxxxxxxxxxxxxxx>smallRNA(si3)
xxxxxxx>smallRNA(se3)                      <------MYB83              --------------->AGL15
xxxxxxxxsmallRNA(si3)  --------->WOX13(2)<---------MYB52(1)          <---------------AGL15         <
----LBD16  --------->GATA12          <---------YAB5    <---------ARR11(3)  <xxxxxxxxxxxxxxxxsmallRNA(s)
xxxxxxx>smallRNA(le3)<---------AHL20(2)  <--------P    --------->ARR11(3)  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
-ZAT14     <---------ARR14(2)     --------->KAN1      <---------GLK1(1)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
>ZAT14     --------->ARR14(2) ----------->GT1    <---------WOX13(2) ----------------->AGL1 <--------
>TEIL <---------MYB52(1)     --------->LBD16<------MYB83        <---------KAN1xxxxxxxxxxxxxxxxxxx>smallRNA(s2)
xxxxxsmallRNA(s)    --------->AHL20(2) <---------MYB46(3)--------->TOE2(3)---------->DOF2  ---------
->HVH21   <------ZmHOX2a(1) <---------LBD16<------MYB46(1)     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
 
ggaaaatctgttaggatttgtgtttaaattgcccggtttaatcggttgggttaatagaaatcttagagtatgcctataaaagaaggaaactcgaaattag  10695300
            <---------DOF5.7(1)
   <---------ANAC58
   <---------ANAC58
xxxxsmallRNA(i)
xxx>smallRNA(se3)                  --------->DOF5.7(1)
xxxxxxsmallRNA(le3)               --------->DOF5.7(1)
xxxxx>smallRNA(i2)      ---------->DOF2
xxxxsmallRNA(si3)    <---------HSFB2a(2)
xx>smallRNA(si3)<---------ANAC58 ---------->DOF2                   <---------RVE1(2)
xxxxsmallRNA(le3)    --------->HSFB2a(2)                      --------->TOE2(3)
xxx>smallRNA(si3) <---------MYB52(1)      --------->CCA1(2) <---------YAB5
----------DOF2  <---------ANAC58 --------->DOF5.7(1)      <---------GLK1(2)                  -------
-WOX13(2)   <---------DAG2--------->DOF5.7(1)       <------ZmHOX2a(1)         <---------ARR11(2)
>WOX13(2)   <----------DOF2 ------------------------>ANAC81--------->GLK1(2) <------ZmHOX2a(1)     <
 
ggctttgcttagccacttttcgttctgtaaagaagaaaaagagagagacggagaaggaccagaatcgttagagtttgggaggaaacagtttcgacatatc  10695400
                            ----------->GT1
                            <---------ZAT6                                            <-----------GT1
                            <---------ANAC58                                        <---------AHL20(2)
                            <---------ANAC58                                        --------->AHL25(1)
                       <------MYB83                                              <---------GATA12
                    >>>>>>>>>CBP60g                                        <---------RVE1(2)
             --------->MYB52(1)--------->KAN1                              --------->GATA12 <-------
             <---------DOF5.7(2)                                           --------->ARR14(2)
           --------->ARR11(3) <---------MYB52(1)    --------->KAN1         <---------ARR14(2)
       ---------->DOF2 <------MYB46(1)             <---------YAB5          <---------GATA12 ========
    <-----------HVH21 --------->MYB59              <---------YAB1          <---------ARR11(2)
-->RVE1(2)--------->YAB1  xxxxxxxxxxxxxxxx>smallRNA(s)                     --------->ARR11(2)
---------ATHB12     >>>>>>>>>SARD1         <----------DOF2      <-----------GT1  --------->GATA12
 
aaatcgttgtcaaagataacgaaatttggtagcgttattcccaagtctttcattgtcattctaaattttacataagtggatttggatttaaactcgctga  10695500
                                                                  ------>ZmHOX2a(2)
                                                                 <------ZmHOX2a(2)
                                                                --------->ARR11(3)
                                                                --------->AGP1
                                          >>>>>>>>>>>>>>>>>LFY  <---------ARR11(3)            ------
                       <xxxxxxxxxxxxxxxxsmallRNA(i)             <---------ARR14(3)            ------
                     xxxxxxxxxxxxxxxx>smallRNA(i)               <---------RVE1(2)             ------
                    ------->MYC3         <------ZmHOX2a(1)      --------->ARR14(2)         ---------
                    <-------MYC3         ================================HOX2a_HOX2a     ------>ZmHOX2a(2)
                   --------->ANAC55(2)   ===============================HOX2a_HOX2a     <------ZmHOX2a(2)
                   --------->ANAC58     *TSS                    <---------ARR14(2)     --------->GATA12
              ----------->HVH21--------->TGA1a                  --------->ARR14(3)     <---------GATA12
          <---------ANAC58     --------->ANAC58                 <---------GATA12       --------->ARR14(2)
          <---------ANAC58     --------->ANAC46                 --------->GATA12       --------->ARR11(2)
          <---------ANAC55(2)  <---------TGA1a      <------------CBF                   <---------ARR14(2)
  <-----------GT1  --------->ANAC58    --------->MYB59        ----------->ARR10        <---------ARR11(2)
---CDC5   <---------ANAC46     --------->ANAC58--------->ALFIN1--------->GLK1(1)  --------->ARR11(2)
=========================================MYC_MYB  <---------RVE1(2)               <---------ARR11(2)
 
gttattttcagtttcgtgagacacgttttctcagacgcgagttaggaccagtggagattgtaactgagatcttggtcttgtctggtttccgatccgcacg  10695600
                   =========================bZIP_DOF
                   <---------ANAC58
                   <---------ANAC46
                   --------->TGA2(1)
                   --------->bZIP60(1)
                   <---------ANAC58
                   --------->ANAC55(2)
                   <---------bZIP60(2)
                   <---------bZIP60(1)
                   <---------TGA2(1)
                   <---------O2
                   <---------TGA1a
                ----------->TGA1                                 <---------MYB46(3)
                ----------->HVH21                                <------MYB83
               <-----------HVH21                                 <------MYB46(1)
              <---------ANAC58                                 <---------MYB52(1)
              <---------ANAC58                                 <--------P
  <---------bZIP60(2)                                        <---------MYB46(3)
  <---------ANAC58 --------->O2                           <---------DOF5.7(2)
  <---------ANAC46 --------->TGA1a                        --------->MYB52(1) <---------TOE1(3)
  <---------ANAC58----------->STF1             <---------GATA12<---------MYB55(1)
<-----------HVH21<---------TGA2(2)             <---------RVE1(2)<---------AtMYB61       <----------DOF2
--->ANAC58<---------HSFB2a(1)            --------->LBD16--------->DOF5.7(2)  <---------TOE2(3)
--->ANAC58--------->HSFC1(2)           <---------LBD16 --------->WOX13(2)    --------->MYB59
--->ANAC46--------->HSFB2a(1)        <-----------GT1   <---------WOX13(2)<---------WOX13(2)
>LBD16    <---------HSFC1(2)     <----------DOF2    <---------RVE1(2)    --------->WOX13(2)       <-
 
agatgtcgtgggaaacttcgtgacgtcttaggctagcttttcaccggagggatttgatagttaacggttggtttttagtttaggttttcgtctttgagac  10695700
                                                                         --------->ANAC55(1)
                                                                         <---------TGA1a
                                                                         --------->ANAC58
                                                              xxxxxxxxxxxxxxxx>smallRNA(i)
                                                        <---------ARR11(2)
                                              <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                              <---------REM1(1)    <-----------HVH21
                                         <---------ANAC58   <---------ZAT14
                                         <---------ANAC58  <---------HSFB2a(2)
                                         <---------ANAC46  --------->HSFB2a(2)
                                    <---------ANAC46    <---------ARR14(2)
                                    <---------ANAC58    --------->ARR14(2)
                                    <---------ANAC58  --------->HSFC1(2) --------->ANAC46
                                    --------->ALFIN1  xxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                    <-----------RAV1(1) --------->ARR11(2)
                                <---------ANAC58      <xxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                                <---------ANAC58      <---------HSFC1(2) --------->TGA1a
                                <-------GAMYB<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                           <----------DOF2   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)
           <---------AHL20(3)  <---------MYB46(3)   <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)         <--
           --------->AHL20(3) <---------AtMYB61    <------ZmHOX2a(1)     --------->ANAC58  ---------
        xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3) <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)         <--------
        <---------RVE1(2) <---------ANAC58   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)         ------>ZmHOX2a(1)
--------MYB52(1)          <---------ANAC58   <xxxxxxxxxxxxxxxxxxsmallRNA(le3)       <---------KAN1
 
tgtttgtttttgatttttatgtccagtttgcttttggttgtgtggcttgttgtaggacgtttctggactgtttcagacgtaagaagagtctctcctagtt  10695800
                                                                                                   x
                                                                                                   x
                                                                                                  <x
                                                                                                  --
                                                                                                 ---
                                                                                                 <xx
                                                                                                 <--
                                                                                                xxxx
                                                                                               -----
                                                                                             <------MYB83
                                                                                             xxxxxxx
                                                                                             <------MYB46(1)
                                                                                            xxxxxxxx
                                                                                            xxxxxxxx
                                                                                           xxxxxxxxx
                                                                                          <xxxxxxxxx
                                                                                         xxxxxxxxxxx
                                                                                         <xxxxxxxxxx
                                                                                         xxxxxxxxxxx
                                                                                         xxxxxxxxxxx
                                                                                         <xxxxxxxxxx
                                                                                         xxxxxxxxxxx
                                                                                         <xxxxxxxxxx
                                                                                         <xxxxxxxxxx
                                                                                       xxxxxxxxxxxxx
                                                                                       <xxxxxxxxxxxx
                                                                                       <xxxxxxxxxxxx
                                                                                       <xxxxxxxxxxxx
                                                                                       <xxxxxxxxxxxx
                                                                                       <xxxxxxxxxxxx
                                                                                       xxxxxxxxxxxxx
                                                                                       xxxxxxxxxxxxx
                                                                                       <xxxxxxxxxxxx
                                                                                      xxxxxxxxxxxxxx
                                                                                      xxxxxxxxxxxxxx
                                                                                      <xxxxxxxxxxxxx
                                                                                      <xxxxxxxxxxxxx
                                                                                     <xxxxxxxxxxxxxx
                                                                                     xxxxxxxxxxxxxxx
                                                                                     <xxxxxxxxxxxxxx
                                                                                     xxxxxxxxxxxxxxx
                                                                                     xxxxxxxxxxxxxxx
                                                                                     xxxxxxxxxxxxxxx
                                                                                    xxxxxxxxxxxxxxxx
                                                                                    <xxxxxxxxxxxxxxx
                                                                                    xxxxxxxxxxxxxxxx
                                                                                    <xxxxxxxxxxxxxxx
                                                                                    <xxxxxxxxxxxxxxx
                                                                                    <xxxxxxxxxxxxxxx
                                                                                    xxxxxxxxxxxxxxxx
                                                                                    xxxxxxxxxxxxxxxx
                                                                                    <xxxxxxxxxxxxxxx
                                                                                    <xxxxxxxxxxxxxxx
                                                                                    <---------YAB1<-
                                                                                    <xxxxxxxxxxxxxxx
                                                                                    <xxxxxxxxxxxxxxx
                                                                                   xxxxxxxxxxxxxxxxx
                                                                                   xxxxxxxxxxxxxxxxx
                                                                                   <xxxxxxxxxxxxxxxx
                                                                                  <xxxxxxxxxxxxxxxxx
                                                                                  xxxxxxxxxxxxxxxxxx
                                                                                  <xxxxxxxxxxxxxxxxx
                                                                                 <xxxxxxxxxxxxxxxxxx
                                                                                 <xxxxxxxxxxxxxxxxxx
                                                                                 xxxxxxxxxxxxxxxxxxx
                                                                                 xxxxxxxxxxxxxxxxxxx
                                                                                 <xxxxxxxxxxxxxxxxxx
                                                                                 xxxxxxxxxxxxxxxxxxx
                                                                                 <xxxxxxxxxxxxxxxxxx
                                                                                 xxxxxxxxxxxxxxxxxxx
                                                                                 <xxxxxxxxxxxxxxxxxx
                                                                                 <xxxxxxxxxxxxxxxxxx
                                                                                xxxxxxxxxxxxxxxxxxxx
                                               --------->RVE1(2)               <xxxxxxxxxxxxxxxxxxxx
                                          xxxxxxxxxxxxxxxx>smallRNA(i)         <xxxxxxxxxxxxxxxxxxxx
                                       <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)    <xxxxxxxxxxxxxxxxxxxx
                                     xxxxxxxxxxxxxxxx>smallRNA(i)             <xxxxxxxxxxxxxxxxxxxxx
                                     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)    <xxxxxxxxxxxxxxxxxxxxx
                                   <xxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)<---------ANAC58xxxxxxxxxxxxxx
                                   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)      <xxxxxxxxxxxxxxxxxxxxx
                                  ----------->HVH21                   <---------ANAC58xxxxxxxxxxxxxx
                                --------->ANAC55(2)          <---------ANAC46 <xxxxxxxxxxxxxxxxxxxxx
                                <---------ANAC46           <------MYB46(1)   xxxxxxxxxxxxxxxxxxxxxxx
                                <---------ANAC55(2)        <------MYB83      <---------ANAC46xxxxxxx
                                <---------ANAC58    xxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)xxxxxxxxxxxxx
                                <---------ANAC58xxxxxxxxxxxxxxxx>smallRNA(i) <xxxxxxxxxxxxxxxxxxxxxx
                            <---------ANAC58   <-----------ARR10      <---------ANAC46<xxxxxxxxxxxxx
 <---------MYB46(3)         <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)<---------AtLEC2<xxxxxxxxxxxxxxxxxx
-------YAB1                 <---------ANAC58  xxxxxxxxxxxxxxxx>smallRNA(i)   xxxxxxxxxxxxxxxxxxxxxxx
------>AGL15               <---------MYB46(3) xxxxxxxxxxxxxxxx>smallRNA(s)   <xxxxxxxxxxxxxxxxxxxxxx
-------AGL15       ----------------------->TaNAC69(2)  --------->ATHB12    <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
 
atagttgttgttagaatcagcttgttatggtgagtgcgtgaccatgagcttatctgagcgattggtttgtatgacttgttttgtgtgatgatatgtaggt  10695900
     xxxxxxxxxxxxxxxxxxx>smallRNA(le3)
    xxxxxxxxxxxxxxxxxxx>smallRNA(se3)
  xxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
  xxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
xxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
xxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
--------->GT1
------>ALFIN1
xxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
-------AtMYB61
xxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
---->ALFIN1
xxxxxxxxxxxxxxx>smallRNA(le3)
xxxxxxxxxxxxxxx>smallRNA(l2)
xxxxxxxxxxxxxxx>smallRNA(le3)
xxxxxxxxxxxxx>smallRNA(se3)
xxxxxxxxxxsmallRNA(fl3)
xxxxxxxxxxx>smallRNA(i2)
xxxxxxxxxxxxxsmallRNA(fl3)
xxxxxxxxxxxx>smallRNA(si3)
xxxxxxxxxxxx>smallRNA(l2)
xxxxxxxxxxxxxsmallRNA(si3)                                                                         <
xxxxxxxxxxxx>smallRNA(le3)                                                                     xxxxx
xxxxxxxxxxxxsmallRNA(si3)                                                                     xxxxxx
xxxxxxxxxxxxxsmallRNA(se3)                                                                    xxxxxx
xxxxxxx>smallRNA(le3)                                                                         xxxxxx
xxxxxxxxxxxsmallRNA(le3)                                                                     xxxxxxx
xxxxxxxxxxsmallRNA(si3)                                                                      xxxxxxx
xxxxxxxxxxxsmallRNA(se3)                                                                  xxxxxxxxxx
xxxxxxxxxxxsmallRNA(fl3)                                                                 xxxxxxxxxxx
xxxxxxxxxxxsmallRNA(si3)                                                                xxxxxxxxxxxx
xxxxxxxxxx>smallRNA(si3)                                                                <xxxxxxxxxxx
xxxxxxxxxx>smallRNA(l2)                                                                xxxxxxxxxxxxx
xxxxxxxxxxxsmallRNA(s2)                                                                xxxxxxxxxxxxx
xxxxxxxxx>smallRNA(i2)                                                                 xxxxxxxxxxxxx
xxxxxxxxx>smallRNA(l2)                                                                 xxxxxxxxxxxxx
xxxxxxxxxsmallRNA(s2)                                                                  xxxxxxxxxxxxx
xxxxxxxxxsmallRNA(si3)                                                                xxxxxxxxxxxxxx
xxxxxxxxxsmallRNA(i2)                                                                xxxxxxxxxxxxxxx
xxxxxxx>smallRNA(fl3)                                                                xxxxxxxxxxxxxxx
xxxxxxxxsmallRNA(le3)                                                                xxxxxxxxxxxxxxx
xxxxxxxx>smallRNA(si3)                                                              xxxxxxxxxxxxxxxx
xxxxxxx>smallRNA(se3)                                                               xxxxxxxxxxxxxxxx
xxxx>smallRNA(se3)                                                                  xxxxxxxxxxxxxxxx
xxxxxxx>smallRNA(le3)                                                              <xxxxxxxxxxxxxxxx
xxxxxxxsmallRNA(le3)                                                               xxxxxxxxxxxxxxxxx
xxxxxx>smallRNA(le3)                                                               xxxxxxxxxxxxxxxxx
xxxxxxxxsmallRNA(le3)                                                              xxxxxxxxxxxxxxxxx
xxxxsmallRNA(le3)                                                                 xxxxxxxxxxxxxxxxxx
xxxxxxxxsmallRNA(si3)                                                             <xxxxxxxxxxxxxxxxx
xxxxxxx>smallRNA(si3)                                                             <xxxxxxxxxxxxxxxxx
xxxxxxx>smallRNA(se3)                                                            xxxxxxxxxxxxxxxxxxx
xxxxxxxsmallRNA(i2)                                                              <xxxxxxxxxxxxxxxxxx
xxxxxxsmallRNA(fl3)                                                              <xxxxxxxxxxxxxxxxxx
--------ANAC46                                                                   xxxxxxxxxxxxxxxxxxx
xxxxxxxxsmallRNA(l2)                                                            xxxxxxxxxxxxxxxxxxxx
xxxxxsmallRNA(fl3)                                                              xxxxxxxxxxxxxxxxxxxx
xxxxxx>smallRNA(i2)                                                             <xxxxxxxxxxxxxxxxxxx
xxxxxx>smallRNA(le3)                                                            xxxxxxxxxxxxxxxxxxxx
xxxxxxsmallRNA(le3)                                                            <xxxxxxxxxxxxxxxxxxxx
xxxxxsmallRNA(fl3)                                                             --------->REM1(2)<xxx
xxxx>smallRNA(se3)                                                             xxxxxxxxxxxxxxxxxxxxx
xxxxxxsmallRNA(si3)                                                            xxxxxxxxxxxxxxxxxxxxx
xxxxsmallRNA(se3)                                                             xxxxxxxxxxxxxxxxxxxxxx
xxxxxsmallRNA(se3)                                                            xxxxxxxxxxxxxxxxxxxxxx
xxx>smallRNA(si3)                                                             <xxxxxxxxxxxxxxxxxxxxx
xxxx>smallRNA(si3)                                                            xxxxxxxxxxxxxxxxxxxxxx
xxxxxsmallRNA(fl3)                                                            xxxxxxxxxxxxxxxxxxxxxx
xxxx>smallRNA(fl3)                                                            xxxxxxxxxxxxxxxxxxxxxx
xxxxsmallRNA(si3)                                                             xxxxxxxxxxxxxxxxxxxxxx
xxxx>smallRNA(le3)                                                            xxxxxxxxxxxxxxxxxxxxxx
xxsmallRNA(le3)                                                              xxxxxxxxxxxxxxxxxxxxxxx
xxxsmallRNA(se3)                                                             <xxxxxxxxxxxxxxxxxxxxxx
xx>smallRNA(si3)                                                            <---------ANAC46 xxxxxxx
xxxsmallRNA(s2)                                                             <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
xxxsmallRNA(fl3)                                                            <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
xxxsmallRNA(le3)                                                            <---------ANAC58<-------
xxsmallRNA(fl3)                                                             <---------ANAC58xxxxxxxx
xxsmallRNA(se3)   --------->MYB52(1)                                        xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
xxxxxxxxx>smallRNA(le3)      --------->ATHB12                               xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(l2)
xxsmallRNA(le3)  <---------WRKY12                                       <---------ANAC58<xxxxxxxxxxx
xxxxxxxxx>smallRNA(si3)      --------->YAB5                             <---------ANAC58<xxxxxxxxxxx
xxsmallRNA(si3)  <---------WRKY38(1)                 <---------YAB1--------->WOX13(2)xxxxxxxxxxxxxxx
>smallRNA(l2)   ----------->HVH21                    <---------TOE1(3)  --------------------->WRI1 <
xxxxxxxxxxxxx>smallRNA(se3) <---------ATHB12         <---------TOE2(3)<---------AHL20(2)xxxxxxxxxxxx
xxxxxxxxx>smallRNA(l2)    xxxxxxxxxxxxxxxx>smallRNA(i)----------->GT1 <-----------GT1xxxxxxxxxxxxxxx
xsmallRNA(i2) <---------ANAC46                --------->AHL25(3)<---------DOF5.7(1)xxxxxxxxxxxxxxxxx
xxxxxxxxsmallRNA(se3)----------->GT1          <---------AHL20(2)<----------DOF2xxxxxxxxxxxxxxxxxxxxx
xxxxxsmallRNA(le3)<---------DOF5.7(2)     <---------YAB1       <---------DOF5.7(1)<xxxxxxxxxxxxxxxxx
>smallRNA(fl3)<---------ANAC58       <---------MYB46(3)    <-----------GT1  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
xsmallRNA(le3)<---------ANAC58       --------->MYB52(2)   --------->KAN4(2) xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
 
gtggtgaatgtgtttttgggtgaacggttcaatgactggtttgttatgttttatttatggttataccctttatttacttgtgtgtatagctcgtagatgg  10696000
<- Previous    Next ->

AGI:  At5g28670.1   
Description:  transposable element gene. pseudogene, similar to putative helicase, predicted helicase proteins, Arabidopsis thaliana; blastp match of 42% identity and 6.8e-154 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)}
Range:  from: 10691741    to: 10695541    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version