AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                        --------->ARR11(3)
                                        <---------ARR11(3)
                                     <---------AHL20(3)
                                     --------->AHL20(3)                                  <---------AHL25(3)
                                     <---------AHL20(2)                                 --------->AHL20(2)
                                     --------->AHL20(2)                        --------->YAB1
                                     <---------AHL25(1)                        --------->TOE2(3)
                             <---------ANAC58                                  --------->YAB5
                         <---------DOF5.7(1)                                  ----------->GT1
                  ---------->ID1     <---------AHL25(2)                  >>>>>>>>>>>>>>>>>LFY<------
                <-----------RAV1(1)  --------->AHL25(1)                  --------->ANAC46--------->AHL20(2)
------>DAG2     <---------MYB46(3)   --------->AHL25(2)            --------->TOE2(3)  <---------AHL12(2)
------>DOF2<---------RVE1(2) <---------ANAC58                     <---------YAB1   --------->AHL12(2)
 
aaagtggttttgttgatatttgttgccatttttcgttcaataaaatcttataaactgaaattcaaacttatcttagacccaatgttaaaaaataaaaaaa  1785500
                                                                                         ------->TEIL
                                                                                     <--------------
                                                                                     ---------------
                                                                                     <--------------
                                                                                  <---------AHL20(2)
                                                                                  --------->AHL20(2)
                                    <---------WOX13(2)                          <---------WOX13(2)
                                    --------->WOX13(2)                          --------->WOX13(2)
   --------->TOE2(3)        <---------ANAC58           <---------YAB1          --------->YAB5  -----
  <---------YAB1        --------->KAN1         --------->AHL20(2)           --------->ANAC46  ------
---AHL12(2) --------->LBD16 <---------ANAC58   --------->YAB1       <-----------GT1  ---------------
 
aacttatcttagaccctgaatacagctatattcgtgtttaactaaaacaataaaacttatatttgaagttattacttccaaacaattaaacgtacttaca  1785600
                                                               --------->ATHB12
                                                               -------->HAHB4
                                                               <---------ICU4
                                                               --------->ATHB51
                                                               -------->ATHB1<---------AHL25(3)
                                                              <---------YAB5 <---------AHL12(1)
                                                              <---------ATHB51    <-----------GT1
                                                              <---------ATHB12 --------->WOX13(2)
                                                              --------->ICU4 --------->AHL20(2)
                                                      <---------MYB59        --------->AHL12(1)
                                                     --------->ANAC55(1)     <---------AHL20(2)
                                                     --------->ANAC58        --------->AHL25(1)
                                                     --------->ANAC55(2)     <---------AHL25(1)
      --------->GLK1(1)                              <---------ANAC58      <---------WOX13(2)
      <---------GLK1(1)                              <---------ANAC58  ----------->GT1
     <---------ARR11(3)                 <---------At4g35610   <---------YAB1--------->ICU4
     --------->ARR11(3)                 ----------->RAV1(2)  --------->AHL12(2)<---------WOX13(2)
-AtSPL8                <-----------------AG          <---------ANAC55(2)   --------->WOX13(2)
>AtSPL8                <-----------------AGL1        --------->ANAC46<---------ANAC46        <------
-AtSPL3                =============================================================================
---->ARR11(3) --------->WOX13(2)        --------->At4g35610  <---------AHL12(2)<---------AHL12(2)
--->REM1(1)   <---------WOX13(2)      <-----------GT1--------->ANAC58<---------ANAC58  <---------ALFIN1
>AtSPL3   <----------DOF2 <---------WOX13(2)        <---------TOE2(3)<---------ANAC58--------->AtMYB61
 
tcttgtaagatttctttagttaacatgtcaattttggaaattcacctgtctcatttacgtaactaattattgccttgtaattaataaaccacaccgagtc  1785700
                                                                                                  --
                                                                                                  --
                                                                                                  --
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
                                                                                                  --
                                                                                                  <-
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
                                                               --------->ANAC58                 ----
                                                               --------->ANAC46                 ----
                                                               <---------ALFIN1                 <---
                                                               --------->ANAC58                 <---
                                                          <-----------GT1                      -----
                                                          --------->RVE1(2)                    <----
                                                          --------->ARR11(2)        <------NtERF2---
                                                          --------->ARR14(2)        --------->LBD16
                                                          <---------ARR14(2)        ------>NtERF2<--
     --------------->AGL15                           --------->At5g28300           --------->ANAC46
     <---------------AGL15                          ----------->GT1                --------->ANAC58<
    <-----------------AG                            --------->TOE2(3)              --------->ANAC58<
    ----------------->AGL3                       --------->ARR11(2)           <xxxxxxxxxxxxxxxxsmallRNA(i)
    <-----------------AGL2                       <---------ARR14(2)       <---------ARR11(3) -------
    <-----------------AGL3                       <---------ARR11(2)     --------->ANAC58     <------
-----HVH21  ----------->GT1                      --------->ARR14(2)     --------->ANAC46   ---------
=====================MADS_MADS --------->ATHB12----------->ARR10        --------->ANAC58 ---------->DOF2
 
accaattgctatttgtggtaaaatactaaattcttgatttaaaacatgggcagaaccgtaatatccacaccattcaagaaatttgtccgccaaaaagata  1785800
         ---------->DOF2
   <---------AHL25(2)
   --------->AHL12(1)
   <---------AHL20(1)
   <---------AHL25(3)
   <---------AHL20(2)
   --------->ARR11(3)
   <---------AHL20(3)
   <---------AHL12(1)
   --------->AHL25(2)
   --------->AHL20(1)
   --------->AHL20(3)
  --------->AHL12(1)
<---------AHL12(2)
--------->AHL12(2)            <---------GLK1(2)
------->AHL20(3)             --------->KAN1
------->AHL20(2)            --------->AHL20(1)
------->AHL25(2)            --------->ARR11(3)
--------AHL25(2)            <---------AHL20(2)
--------AHL20(1)            <---------AHL25(3)
------->AHL25(3)            --------->AHL20(2)
------->AHL20(1)            <---------AHL20(1)
--------AHL20(2)            <---------AHL12(1)
--------AHL25(1)            --------->AHL12(1)
--------AHL20(3)            <---------ARR11(3)
------->AHL25(1)            --------->AHL25(2)
----->WOX13(2)              --------->AHL20(3)
----->AHL12(2)              --------->AHL25(3)
------AHL12(2)              <---------AHL25(2)                                                <-----
------WOX13(2)              <---------AHL25(1)                                               -------
---->AHL12(1)               <---------AHL20(3)                                               <------
-----AHL12(1)               --------->AHL25(1)                                               <------
------>AHL12(2)            --------->AHL20(2)                                                -------
-------AHL12(2)     ----------->GT1                                                          <------
---------AHL20(2)  --------->DOF5.7(1)                                           <-----------GT1
---------AHL25(3)  --------->DAG2   <----------DOF2                             <---------CCA1(2)<--
-->ARR11(3)       ---------->DOF2  <---------DOF5.7(1)<------ZmHOX2a(1)     <---------DAG2  <-------
---ARR11(3)       --------->DOF5.7(1)               <---------TOE2(3)       <----------DOF2 <-------
-->GT1 <---------YAB1      --------->AHL12(3) ----------->HVH21         <---------KAN1<---------At4g35610
 
atttaatattttgaaagaaaaaaaagtcaaatatattctctttctactcgtgactgaggaagagaaacagagagcataactttatatccagccgattttt  1785900
        <-----------GT1
      <---------ANAC58
      <---------ANAC58
----AHL12(2)
-->AHL12(2)
---AHL25(2)
---AHL20(2)                --------->ANAC58
-->AHL25(1)                *TSS           <----------DOF2
---AHL12(3)          --------->ZAT6      --------->TOE2(3)                  <----------DOF2
---------GT1<----------DOF2--------->ANAC58          <---------ZAT6        <---------DOF5.7(1)
--AHL12(1) <---------DAG2---------->DOF2----------------->AG       <----------DOF2 ---------->DOF2
--DOF5.7(1)<---------DOF5.7(1)  --------->KAN1   <---------YAB5   <---------DOF5.7(1)              -
 
tttcaaatttcttaccttttgctctcactaaagccatgttcttacctttatagtgagtgttatctaaactcttttgggtcttttgcaaaagaaaccagtt  1786000
                                                        ------>ZmHOX2a(2)
                                                      --------->ARR11(2)
                                               <---------ANAC46
                                              <---------LBD16
                                           <---------At4g35610       --------->ANAC58
                                           --------->At4g35610       --------->ANAC58
                                           <---------ZAT2         --------->DOF5.7(1)
                                           --------->ZAT2<---------HSFB2a(2)
                                        ----------->ARR10--------->HSFB2a(2)                   -----
                                      --------->ZAT14 --------->GATA12                        <-----
         <---------AHL25(2)           <---------ZAT14 <---------ARR11(2)                      ------
         --------->AHL25(2)    --------->GLK1(2)      <---------GATA12       <-----------GT1  ------
--------->DOF2            ----------->GT1 <-----------ARR10     ---------->DOF2               <-----
 
ttcaaagttcaaaattttgtttttaaaaatggagaatttagtgaagagctgcgcagggatcgagaagaaaagaagcaatttgactccatcgatggaagat  1786100
                                                                                             -------
                                                                 <-----------HVH21        <---------ALFIN1
                                                                --------->DEAR3(1)        --------->DEAR3(1)
                                                             --------->DEAR3(1)           --------->AtMYB61
                                                             <---------ALFIN1            <---------MYB55(2)
                                                          --------->DEAR3(1)             --------->MYB46(3)
                                                         --------->MYB46(3)            <---------ALFIN1
                                                <---------At4g35610 <---------DEAR3(2) --------->DEAR3(1)
                                       <---------ZAT2  --------->ANAC46                --------->AtMYB61
          ---------->DOF2              <---------At4g35610--------->AtMYB61           --------->MYB46(3)
         <---------WRKY38(1)           --------->ZAT2  <---------ALFIN1             --------->DEAR3(1)
         <---------WRKY12              --------->At4g35610<---------ALFIN1          --------->AtMYB61
---->CCA1(2)                         --------->ZAT18 ------>ZmHOX2a(1)     <---------DOF5.7(1)<-----
----ARR11(3)                 --------->MYB52(1)--------->HSFB2a(1)<---------MYB52(1)<---------ALFIN1
--->ARR11(3)            --------->At4g35610  ---------->DOF2 --------->AtMYB61     --------->MYB46(3)
--->ARR14(2)           ----------->RAV1(1) --------->ANAC58 --------->MYB46(3)   <---------ALFIN1  <
----ARR14(2)         --------->At4g35610   --------->ANAC58 <---------MYB55(2)   --------->ANAC46  <
 
atacttacagagtcaaaggagagaagcagcactagcggagcgagctacgaaagctcctccaccaccaccgtcgcttcgtcttctccaccaccaccaccgt  1786200
          <---------AtMYB61
         <--------P
        <---------ANAC58
        <---------ANAC58
        <-------GAMYB
  --------->GLK1(2)
 <---------ARR11(2)
 --------->GATA12
 <---------GATA12
 <---------RVE1(2)                                                         <---------WOX13(2)
 <---------GLK1(2)                                                 --------->YAB1
 --------->ARR14(2)                                            <---------YAB1
 <---------ARR14(2)                                        <---------WOX13(2)
 --------->ARR11(2)                                        --------->AHL12(2)              ---------
--------->KAN1 --------->YAB5                              <---------AHL12(2)              ---------
-->DEAR3(1)<------MYB83                                    --------->WOX13(2) <-----------GT1
------HVH21<------MYB46(1)                            <---------ZAT6       --------->WOX13(2)
---------TOE2(2)            <-------TEIL         <------ZmHOX2a(1)<---------YAB1          <---------YAB1
---------TOE1(2)      ---------->DOF2   --------->KAN1----------->GT1      <---------AHL12(2)
 
cgcagattctgggttggccgattagaaaagcttcatttcggaaaaattcgaaggagagtgttaattttgatcataagaaattaacccttcacgatgattc  1786300
                                                                              ------>ZmHOX2a(2)
                                          --------->RVE1(2)                 --------->RVE1(2)
                                   ----------->GT1                          <---------ARR11(3)
                             <--------P --------->AHL12(1)                  --------->ARR11(3)
              --------->CCA1(2)  <---------ZAT6          <---------DAG2     <---------AGP1 <--------
   ---------->DOF2 <---------GLK1(1)    <---------AHL12(1)                  --------->GATA12
>YAB5      --------->DOF5.7(1) --------->MYB52(2)        <----------DOF2    <---------GATA12 <------
>KAN1    ---------->DOF2 <-----------RAV1(2)    --------->DAG2<-----------GT1<------ZmHOX2a(2)
 
tgggtttaaagcgaaagagatgaattctgcaggttagtgagaaaaaatcaaaaattgaaacttttttactcagccctaagatctcatgtgttttctttgt  1786400
<- Previous    Next ->

AGI:  At5g05940.1   
Description:  ATROPGEF5/ROPGEF5 (KINASE PARTNER PROTEIN-LIKE); Rho guanyl-nucleotide exchange factor/. similar to ATROPGEF7/ROPGEF7 (KINASE PARTNER PROTEIN-LIKE), Rho guanyl-nucleotide exchange factor/ [Arabidopsis thaliana] (TAIR:AT5G02010.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO69097.1); contains InterPro domain Protein of unknown function DUF315, plant (InterPro:IPR005512)
Range:  from: 1785928    to: 1788437    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version