AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                <---------AHL20(2)
                                            --------->AHL20(2)
                                            <---------AHL20(2)
                                            --------->AHL25(1)
                                            --------->AHL12(3)
                                            --------->AHL25(3)
                                            <---------AHL25(1)
                                            <---------AHL12(3)
                                     --------->GATA12
                                     --------->RVE1(2)
                                     <---------ARR14(2)
                                     <---------GATA12                        --------->ANAC58
                                 <---------At4g35610        --------->TOE1(3)--------->ANAC58
                              ------->GAMYB --------->AHL12(1)      <----------DOF2
   --------->TOE2(3)         --------->ANAC58   --------->AHL20(2) --------->YAB5
   --------->TOE1(3)         --------->ANAC58 <---------WOX13(2) --------->GATA12         --------->ARR11(3)
   <---------MYB59           --------->ANAC46 --------->WOX13(2) <---------ARR11(3)     --------->DOF5.7(1)
--ZmHOX2a(1)            --------->ANAC58    <---------AHL12(1)   --------->ARR11(3)   ---------->DOF2
-----ID1                --------->ANAC58   --------->AHL25(3)   <---------CCA1(2)--------->RVE1(2)
--At4g35610           ---------->DOF2<---------ARR11(1) ---------->DOF2  <---------MYB52(2)
->At4g35610     --------->WOX13(2)   --------->GLK1(2) --------->AtMYB61 --------->MYB46(3)
 
acaaaacctaaatcagacaaattagcaaagcaacgcagcaaatctatataatttaaaaccaaagcttaaatctttaacaaacccaatccaaaagagctag  18417100
                                                ---------->DOF2
                                       ----------->HVH21
                                     <---------------AGL15
                                     --------------->AGL15
                                     <---------At4g35610
                                     ------>ZmHOX2a(1)                   --------->TOE1(3)
                               <---------HSFC1(2)         --------->ANAC58              <---------KAN1
                               --------->HSFC1(2)         ----------->GT1--------->TOE2(3)
     <---------ICU4      <---------ANAC58   ----------->GT1<------ZmHOX2a(1)          --------->YAB1
   <---------TOE2(3)     <---------ANAC46  <---------MYB46(3)    ----------->GT1<-------TEIL
  ---------->DOF2        <---------ANAC58 <---------ANAC46--------->ANAC58   --------->KAN1      <--
 
aagtttaaagatgacttacaacaaaatggcttgaaacttcctctgatgggtaaaagaaggcaggaaaaatgtaaaaccctaaattcgtagcataagaaga  18417200
                                                     <---------AHL12(1)
                                      --------->ANAC58
                                      --------->ANAC58
                          --------->YAB1             --------->AHL20(2)
                         <<<<<<<<<ARR2<---------ANAC55(2)                                    <------
                        --------->RVE1(2)            <---------AHL20(2)                      <------
                       --------->WOX13(1)            <---------AHL25(3)                      <------
                --------->ANAC58     --------->SPL7(1)                                       -------
                --------->ANAC58     --------->SPL1(2)                                       -------
            --------->CCA1(2)      <---------SPL7(1) --------->AHL12(1)                --------->ANAC46
   --------->YAB5     --------->MYB46(3)            --------->AHL20(3)        <---------RVE1(2)
-------KAN1<----------ID1<---------ATHB12  --------->YAB5                     <---------GLK1(2)  <--
 
atgaaacaattagagagacaagacaacaatcaaaacccagtacggaagattacaaatttatcaaatttccgactcaaaatagattcttcaacaccagatt  18417300
                                                   <---------HSFB2a(2)
                                                   --------->HSFB2a(2)
   <---------DOF5.7(1)                          <---------GATA12
---ARR11(3)                                 --------->ANAC58                         <-------GAMYB
---GLK1(2)                          --------->TOE1(3)  --------->ANAC58             <---------MYB46(3)
---GATA12                    --------->ANAC58   --------->GATA12                   <---------AtMYB61
-->ARR14(2)           --------->DOF5.7(1)   --------->ANAC58   --------->MYB52(1)<----------DOF2 <--
-->GATA12           ---------->DOF2 --------->TOE2(3)  --------->ANAC58         <---------DOF5.7(1)
---------GT1   >>>>>>>>>TBF1 --------->ANAC58  --------->GLK1(1)            ----------->HVH21-------
 
ttactctcttaagacgaagaagaaaaagaagaacgcaaaccttaaaaacgaaatccagaagcaatggaacggagagagagtgacctttggttgaagaatt  18417400
                                                       --------->DAG2
                                                    <---------------AGL15
                       <---------KAN1               --------------->AGL15
                     <<<<<<<<<<<<<<<<<LFY          <-----------------AG
                  <---------At4g35610       <-----------TGA1
                 --------->DOF5.7(1)        <-----------HVH21                      --------->ARR14(2)
                --------->DAG2             --------->ANAC55(2)                     <---------ARR14(2)
                --------->DOF5.7(1)        <---------ANAC55(2)          --------->DOF5.7(1)
         ---------->DOF2                   --------->ANAC46           ---------->DOF2
       <---------KAN1------>NtERF2 <-----------GT1 <-----------------AGL3    <---------DEAR3(1) ----
-------YAB1    ---------->DOF2   --------->AHL12(1)<-----------------AGL1   <------ZmHOX2a(1) <-----
-->GLK1(1)   --------->ARR11(3) <---------KAN1<---------ICU4    <---------KAN1 <------NtERF2  <-----
 
ctaatcgagaatgaaagataaagcggacattgggaatttttctatcccgtcattacaaaaattgggaattttggaaagaggaggcgaattctagggttct  18417500
                                                                                               -----
                                                                                               -----
                                                                                               -----
                                                                                      <---------DAG2
                                               --------->ICU4                         <---------DOF5.7(1)
                                               <---------YAB1                         <----------DOF2
        <---------MYB46(3)                    <---------RVE1(2)                      <---------DOF5.7(1)
       <---------AtMYB61             --------->At4g35610                          <-----------GT1
     <---------ANAC46               <---------ARR14(2)                   --------->YAB5<---------DOF5.7(1)
----->KAN1             *TSS--------->KAN1   <---------ZAT6       ----------->GT1 <-----------GT1
----ANAC58          <---------LBD16 --------->ARR14(2)         <------------CBF<---------WOX13(2)
----ANAC58     <---------RVE1(2)   <------ZmHOX2a(1)      <------------CBF     --------->WOX13(2)---
 
tgttcgtcgagtggttttgatattggggaaaaactcgaggacctgaagtgataatgggtcgcattgtattgtgaaatgtctaaattaccctttttctcaa  18417600
                                                                   <---------ARR14(2)
                                                                   --------->ARR14(2)
                                                                   <---------ARR11(2)
          <---------ANAC46                                        --------->ATERF1(1)
          --------->DEAR3(1)                                <---------LBD16
          <---------DEAR3(1)                       <---------AHL12(2)
       --------->ANAC46                            <---------YAB1<---------ATERF1(1)
       <---------DEAR3(1)                         --------->AHL20(3)
      --------->SPL7(1)                           <---------AHL20(2)
    <---------SPL7(1)                             --------->AHL25(2)
  <---------------AtSPL8                          <---------AHL20(3)     <-----------ARR10    <-----
  <---------------AtSPL3                          <---------AHL25(2)   --------->LBD16        ------
---->ANAC58 <------NtERF2                        *TSS <-----------GT1<------NtERF2  --------->SPL7(1)
---->ANAC55(2)<---------DEAR3(2)                <---------YAB1--------->LBD16      <---------MYB52(1)
---->ANAC58------>NtERF2<----------DOF2      <---------YAB1--------->MYB52(1)     <---------SPL7(1)
------>AHL20(2)  ------------>CBF         <---------ARR14(2)----------->RAV1(2)   <-----------HVH21
 
gtaattttgtacggcgtcgtttcaatgcttttggggttttcagagaatactattattttactcaccggaggctccgagtcttctccgtccgtcgtaacat  18417700
                                      ------>NtERF2
                                     --------->ANAC58
                                     --------->ANAC58
                                  ----------->HVH21
                                --------->ANAC58
                                --------->ANAC46                               --------->AHL12(2)
           <---------DEAR3(1)   --------->ANAC58                               <---------AHL12(2)
          --------->SPL7(1)     <---------O2                        ------->TEIL
        <---------SPL7(1)       --------->O2                   ----------->RAV1(2)  --------->TOE2(3)
       --------->KAN1         --------->CCA1(2)                <---------ANAC46<---------WOX13(2)
----ARR11(3)    <-------GAMYB--------->ARR14(2)            --------->YAB5      --------->WOX13(2)
--->ARR11(3)  <---------ANAC46--------->KAN1     <---------LBD16 ------>ZmHOX2a(1)--------->RVE1(2)
 
cttcgctctctcgttcggcgtttgtatcaccagagacgcgacgcgataatgcttcggaagtatgtttcctgaaccctaagtttattatctcaatccatct  18417800
                                                       --------->AHL20(3)
                                                       --------->AHL20(2)
                                            <---------ANAC58           --------->WOX13(2)
                                            <---------ANAC58      ------>ZmHOX2a(1)
                                         <----------DOF2          ==================================
                                        <---------ANAC58          <---------------AGL15
                                     <---------CCA1(2) <---------AHL20(2)
                                   <---------ANAC46    <---------AHL20(3)
                                   --------->ANAC55(2) --------->AHL25(1)
                                   <---------ANAC58    --------->AHL25(2)
                                   <---------ANAC58    <---------AHL25(2)
                                   <---------ANAC55(2) <---------AHL25(1)                     <-----
                       <---------ATHB12 <---------ANAC58   <---------YAB5                     <-----
         <---------ANAC58       <---------MYB52(1)  <---------RVE1(2)  <---------WOX13(2)   <-------
         <---------ANAC58--------->WOX13(1) <---------ANAC46--------->YAB5                <---------
 
tgttgaattttggcttctcttgttccatcaatctcgttgcgtagctttcgggtctgattttattgattcctctaaattgagagctatttgtgactttgat  18417900
                                                                                            --------
                                                           --------->At4g35610             ---------
                                                           <---------ZAT2                 --------->HSFB2a(2)
                                                  <---------MYB46(3)                   --------->GLK1(2)
                                                  <------MYB83                         <---------GLK1(1)
                                                  <---------DEAR3(2)                   --------->GLK1(1)
                                                  <------MYB46(1)                     <---------GLK1(2)
                                                 <---------DEAR3(1)                  --------->KAN1
                             <-----------RAV1(1) --------->MYB59                  --------->DOF5.7(1)
                 <---------KAN1                 <---------ORA47(1)              --------->YAB1
        --------->YAB1    <-----------RAV1(1)--------->MYB59                    ---------->DOF2
==============================MADS_MADS      <---------AtMYB61         <---------MYB52(1) <---------HSFB2a(2)
----RVE1(2) ----------------->AG          <---------ANAC58 <---------At4g35610  ====================
----GLK1(2) <-----------------AGL2  <---------DOF5.7(1)<---------HSFB2a(2)     <---------ATHB12<----
--YAB1  --------->YAB5   <---------TOE2(3)<---------ANAC58 --------->ZAT2     --------->WOX13(2)
-DOF2  <---------YAB5 <----------DOF2<----------DOF2   --------->HSFB2a(2)    <---------WOX13(2)  <-
 
tctcttgtgaatcataccgaatgtggtttatgttgttgctcttttgcttaggtcggttctcgagctgtcttctcgtttgtcaataaagagattcccgagg  18418000
<- Previous    Next ->

AGI:  At4g39680.1   
Description:  SAP domain-containing protein. similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G26630.2); similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G26630.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO71797.1); contains InterPro domain DNA-binding SAP; (InterPro:IPR003034)
Range:  from: 18414300    to: 18417524    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g39690.1   
Description:  similar to unknown [Populus trichocarpa] (GB:ABK94999.1); contains domain PTHR15415 (PTHR15415)
Range:  from: 18417650    to: 18421965    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version