AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                   <---------ALFIN1
                                  <---------SPL7(1)
                                  <---------ABI4(2)
                                --------->ATERF1(1)
                              --------->ARR11(2)                                --------->RVE1(2)
                              <---------ARR11(2)                             <-----------GT1
                            --------->ZAT14                             <---------DAG2
                           <---------REM1(1)                           --------->HSFB2a(1)
                       --------->SPL7(1)                           --------->ANAC58
                     <---------SPL7(1) --------->YAB5              --------->ANAC46
                 --------->ANAC58--------->ANAC46                  --------->ANAC58            <----
          <------ZmHOX2a(1)--------->ALFIN1      <---------KAN1   --------->SPL7(1)        ---------
--------->KAN1   --------->ANAC58--------->RAP2.6(2)            <---------SPL7(1)        --------->ARR11(3)
------NtERF2     --------->ANAC46--------->DEAR3(1)     --------->YAB5------->TEIL   ---------->DOF2
 
ccagcattcgataggattccaggccatacggtgtagccgcaccgattagcgaatgtgaatgttgagccatacgaaccttttaacatccaaaagataaaga  18067800
            --------->DOF5.7(1)
           --------->AHL25(2)
           --------->AHL20(2)
           <---------AHL25(2)
   --------->YAB5                           <---------YAB1
  <---------ATHB12                       --------->GATA12                           <<<<<<<<<TBF1
 --------->RVE1(2)------->TEIL           <---------GATA12                          <---------------AGL15
------ID1  <---------AHL12(3)   <---------KAN1      <----------DOF2              <<<<<<<<<TBF1
->DOF2     <---------AHL25(1)   <---------ZAT6 <---------WOX13(1)       --------->KAN1
 
aacaaatcactaaaaaaaatgaaactttgaaacgagtgtaagtagatgtgatagactttgaagtaagtgagtgagagactcttcttcttcttctggttat  18067900
                                                                         <---------YAB5
                                                   <------NtERF2         <---------YAB1
                                                   ----------->HVH21   <---------ICU4         <-----
                       ---------->DOF2            ------>NtERF2        --------->YAB1    <---------YAB5
                  --------->ZAT14                <---------ANAC58     <---------YAB1 <---------SPL7(1)
                  <---------ZAT14                <---------ANAC58     <---------YAB5<---------ANAC58
           --------->DOF5.7(1)          --------->ALFIN1       --------->DOF5.7(1)  <---------ANAC58
          ---------->DOF2   <xxxxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)--------->YAB1 --------------->AtSPL3
      --------->At4g35610 <---------At4g35610   <-----------------------TaNAC69(2) ---------->ID1
      <---------At4g35610 --------->At4g35610--------->DOF5.7(1)   <-------TEIL<----------DOF2------
 
acctgtggaagctaaaaggagaacagtgaagctcaatgtgagagtggaagaggcgcgacgagaagaaagattcatcatggttctttgtcgtactcagtgt  18068000
                                  <---------TOE2(3)
                                  <---------RVE1(2)
                              <----------DOF2
                        <---------ARR11(3)
                        --------->ARR11(3)
----ZAT14           ---------->DOF2<-----------RAV1(1)
--->ZAT14  -------->P --------->DOF5.7(1)                   ----------->GT1                       --
 
tcttggtctattctaaccagaagtaaaggtcttctttgatgttgggaagaagatgagagagattagtaaaactgtgaagctatttgagttgaaatggggt  18068100
           <---------ANAC58
           <---------ANAC58                                                            ------->TEIL
     <---------AHL20(2)                                                          --------->ATHB12
     --------->AHL12(3)                                                          --------->ATHB51 *TSS
     <---------AHL20(3)                                                         <---------YAB1  ----
     --------->AHL20(3)      <---------ZAT6                                  --------->ICU4     <---
     <---------AHL25(1)    <---------ANAC58              <<<<<<<GRF7     <---------ZAT14       -----
   --------->AHL12(2)      <---------ANAC58            ----------->HVH21 <---------ZAT18      <-----
   <---------AHL12(2)      <---------ANAC46 >>>>>>>>>>AtWER              --------->ZAT14      <-----
--------->GT1        <---------YAB1 <---------ZAT18  ----------->RAV1(2) --------->ZAT18 <---------DOF5.7(1)
 
tttgttatttttttccttgaatttgttattgagtgttactgggctctatgcctgaaacctgacaaaatttctcttgtgcacttattattgaatcttttta  18068200
                                                                                                  <-
                                                                                                  <-
                                                                                                  <-
                                                                            <---------YAB1        <-
                                                                            --------->AHL25(3)    --
                                                                           --------->AHL20(3)     <-
                                                                           --------->AHL25(2)    <--
                                                                           <---------AHL20(3)    <--
                                                                           <---------AHL25(2)    ---
                                                                           --------->AHL12(2)    <--
                                                                          <---------ICU4         ---
                                                                          <--------HAHB4         <--
                                                                         <---------YAB1          ---
                                                                       --------->YAB1            ---
                                                                       <---------ICU4            <--
                                                                      <---------YAB5             ---
                                                                   <---------ICU4                ---
                                                                  <---------YAB5              ------
      --------->WOX13(2)                                          <---------YAB1              ------
      --------->YAB1                   --------->CCA1(2)          --------->ICU4              ------
    --------->AHL20(2)            <------ZmHOX2a(1)             --------->YAB5                <-----
----------->GT1                  <------MYB46(1) ------>MYB46(1)--------->YAB1                <-----
----->WOX13(2)        --------->ARR11(3)    <------ZmHOX2a(1)  <---------YAB1               --------
------WOX13(2)        <---------ARR11(3)<---------RVE1(2)     --------->ARR11(3)            <-------
---->ATHB12<----------ID1       --------->MYB111(1)      ------------>CBF--------->ICU4     <-------
----AHL20(2)      ---------->DOF2<------MYB83    ------>MYB83 --------->RVE1(2)             --------
----YAB1 --------->YAB5        <--------P--------->CCA1(2)    <---------ARR11(3)      ----------->GT1
 
attgggttaaaataactacaaaaaagatttatgggtaggaagagataggaccaaatggttttcaatatcattattcattattatttcacttgtaaaaaaa  18068300
                                                           <-------TEIL
                                                       <---------YAB1
                                                       <---------AHL12(2)
                                                      --------->AHL25(2)
                                                      --------->AHL20(2)
                                                      <---------AHL25(2)
                                                      <---------AHL25(3)
                                                      <---------AHL25(1)
                                                      --------->AHL25(1)
                                                      <---------AHL20(2)
                                                      <---------AHL12(3)
                                                      --------->AHL12(3)
                                                     --------->AHL20(2)
                                                     <---------AHL20(2)
                                                     --------->YAB1
                                                   <---------WOX13(2)
                                                   --------->WOX13(2)
                                                   <---------AHL12(2)
--------AHL25(3)                                  <---------AHL25(3)
--------AHL25(1)                                 <---------AHL25(1)
--------YAB1                                     --------->AHL25(1)
--------AHL20(2)                                 <---------AHL25(3)
------->AHL25(1)                                 --------->AHL25(2)
--------AHL12(3)                                 <---------AHL12(3)
-------AHL25(3)                                  <---------AHL25(2)
-------AHL25(2)                                  --------->AHL25(3)
------>AHL25(1)                                  --------->AHL12(3)
-------AHL25(1)                                  <---------AHL12(1)                          -------
------>AHL25(2)                                  --------->AHL12(1)                         --------
-------AHL20(3)                                  --------->AHL20(1)                   <---------YAB1
------>AHL25(3)                                  --------->AHL20(2)                 --------->YAB1
------>AHL20(1)                                  <---------AHL20(2)                 <---------ICU4
-------AHL20(1)                                 <---------AHL20(2)                  --------->YAB5
------>AHL20(2)                                 --------->AHL20(2)                 --------->ICU4
------>AHL20(3)                                 <---------AHL25(2)                 <---------YAB1
--->AHL25(2)             --------->ARR11(2)     --------->AHL20(3)               <---------ICU4
--->AHL12(3)             <---------ARR11(2)     --------->AHL25(3)               --------->YAB1
--->AHL20(2)             <---------ZAT14        <---------AHL20(3)              --------->ICU4 <----
----AHL12(2)           --------->REM1(2)        <---------AHL12(3)             <---------AHL20(3)
----AHL12(3)        <---------ANAC46            --------->AHL12(3)             <---------AHL25(2)
->AHL20(3)    <---------RVE1(2)                 <---------AHL25(1)            --------->AHL12(2)
--AHL20(3)  <---------YAB5                     <---------WOX13(2)        ----------->GT1    --------
--AHL20(2)  --------->ICU4                     --------->AHL12(2)      <---------ANAC46--------->YAB5
->AHL20(2)  <---------YAB1                     --------->WOX13(2)<---------YAB1--------->AHL20(3)
 
tataattgtattgttatgattttctgtgtatactagtactactatgtctaaattaattaaaattcattttcattttgtgtaaaattatgatgacaacgcc  18068400
                                                                                    <------NtERF2
 <---------AHL20(2)                                                      <---------ANAC58
 --------->KAN1                                                          <---------ANAC58        ---
--------->ICU4                                                     --------->WOX13(2)         <-----
<---------YAB5                                                     <---------WOX13(2)  <-----------RAV1(2)
--------->AHL25(3)    <------ZmHOX2a(1)                           --------->ATHB12 <---------DEAR3(2)
>GAMYB          <---------ANAC58                            <---------ALFIN1      <---------DEAR3(1)
->DEAR3(1)      <---------ANAC58                            ----------->RAV1(1)  --------->RAP2.6(3)
-----ANAC46    <---------MYB46(3)                          <---------ZAT18   ---------->DOF2  ------
->ANAC46--------->RVE1(2) <----------DOF2<---------AHL12(2)--------->ZAT18<----------DOF2  ---------
 
gtatttattcgtatcaattggttgaggagctttgtctgtgtaaaaaaaaactatgttattagcccacactaattgggcttgaaagtcggcccatgtgaag  18068500
       --------->ARR14(2)
       <---------ARR14(2)
       --------->PCF2                                                        ------>MYB46(1)
       <---------PCF2                                                        -------->P
       --------->TCP11(2)                                                    --------->MYB52(1)
       <---------ARR11(2)                                                    ------>MYB83
       --------->ARR11(2)                                                   --------->MYB55(1)
       --------->PCF5                                               --------->DOF5.7(1)
       --------->TCP16(1)                                          --------->DAG2
       --------->TCP20                                             --------->DOF5.7(1)
      <---------TCP16(2)                                          --------->DOF5.7(1)
     <---------ZAT18                      ---------->DOF2         --------->DAG2
     --------->ZAT18              <----------ID1                 ---------->DOF2         <<<<<<<<<MYB98
    --------->ALFIN1              --------->DOF5.7(1)    --------->ALFIN1  <---------MYB111(1)
---------->DOF2                 ---------->DOF2        <----------DOF2     <---------MYB59 ---------
------>ALFIN1                   --------->DOF5.7(1)  <---------HSFC1(2)    --------->AtMYB61
----AtMYB61--------->LBD16  --------->ANAC58        --------->GLK1(2)      <---------MYB46(2)    <--
--->DOF5.7(1)        --------->ANAC46 ---------->DOF2--------->HSFC1(2)    --------->MYB46(3)    ---
-->HVH21 <---------LBD16    --------->ANAC58--------->DOF5.7(1)  --------->DOF5.7(1)    --------->TOE2(3)
 
gtggaaagtggacccgcgttcaaaacacaacaagaaaaagacaaagaaagatgagaagctttggggctaaaagggggacctaccgaaactatgttaaagc  18068600
                                                                                <---------ANAC58
                                                                                <---------ANAC46
                                                                                <---------ANAC58
                                                                             <---------WOX13(1)
                          --------->ANAC46                                 <---------ICU4
 <---------ICU4        --------->ZAT14                                     --------->ATHB12
<---------YAB5  --------->ETT(2)           <<<<<<<<<SARD1                 --------->ICU4
<-------TEIL    --------->ZAT18 --------->TOE2(3)                         <---------YAB1          --
->DOF2   <---------YAB1<---------ZAT18     <<<<<<<<<CBP60g             <---------YAB1            ---
-------KAN1 <---------WOX13(1)  <----------DOF2 <----------DOF2      --------->YAB1             <---
------>KAN1<---------RVE1(2)    --------->TOE1(3)    --------->KAN1  ----------->GT1     <----------
 
atattcatttctgtgattgtccacagtccacataactttaaacccaaatttctttgaaattcgagttttgaatcgtgataattgcttatttttcacaatc  18068700
<- Previous    Next ->

AGI:  At4g38660.1   
Description:  thaumatin, putative. similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G24180.1); similar to unknown [Populus trichocarpa] (GB:ABK92515.1); contains InterPro domain Thaumatin, pathogenesis-related (InterPro:IPR001938)
Range:  from: 18066171    to: 18068199    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version