AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                               <---------RVE1(2)
                                                                               <---------GLK1(2)
                                        --------->YAB1                         --------->ARR11(3)
          --------->At4g35610        <---------AHL12(2)                        <---------ARR11(3)
          <---------At4g35610      --------->AHL20(3)                      --------->CCA1(2)
     --------->ANAC58              --------->AHL20(2)                   --------->DOF5.7(1)
     --------->ANAC55(2)           --------->AHL25(2)                 ---------->DOF2
     <---------ANAC55(2)           <---------AHL20(3)              --------->ANAC58
     --------->ANAC46              <---------AHL12(3)             <---------TOE1(2)
     --------->ANAC58              --------->AHL25(1)             --------->SPL7(1)
  --------->TOE2(2)                --------->AHL12(3)           --------->TOE2(2)
<-----------ARR10            <----------ID1      <---------AHL20(2)--------->ANAC58
--------->ARR14(2)           ----------->GT1--------->ARR11(3)  <---------SPL7(1)
--------->RVE1(2)          ----------->GT1  <---------ARR11(3)  --------->TOE1(2)
<---------GATA12          --------->DOF5.7(1)  <----------DOF2<---------------AtSPL8
--------->GATA12         --------->MYB52(1) --------->GLK1(2) <---------------AtSPL3 <---------ANAC58
---->HSFB2a(2)        <---------ANAC55(2)  <---------GLK1(2)  --------------->AtSPL3 <---------ANAC58
-----HSFB2a(2)      <---------KAN1--------->AHL12(2)      --------->AHL20(2) ----------->ARR10  <---
 
acaaatctacgtaatctgagagaataagtaaggggaaaaaaaataagaatcttttattgcataaaatcgtacgaaaagataagatttttcgtctgaaaaa  17506600
              <---------YAB1
            <-----------GT1
            --------->ZAT6
       <---------AHL12(2)
      <---------AHL20(2)
      <---------AHL12(3)
      <---------AHL25(3)
      --------->AHL25(1)                                                                          <-
      --------->AHL12(3)                       --------->RVE1(2)                                  <-
      <---------AHL25(1)                       <-----------ARR10                                  <-
     --------->AHL25(3)                        <---------GATA12                               ------
     --------->AHL20(2)                        <---------ARR11(3)                            -------
     --------->AHL12(1)                        --------->GLK1(2)         --------->YAB5      <------
     <---------AHL12(1)                       --------->RVE1(1)   <---------RVE1(2)          <------
   --------->GATA12                          --------->AHL12(1) <---------YAB5               -------
   --------->ARR11(3)                   ----------->GT1   --------->YAB5<---------YAB1       <------
   <---------ARR11(3)               ------->TEIL          --------->ATHB12                   <------
-------ID1<-----------GT1         <<<<<<<<<EIN3--------->ARR11(3)--------->ATHB12        --------->ANAC46
 
cgacaagatttattttcactattgaaggaattgacaatgtatatagaaaaaatctactcactgattagtgatttgatgaatagtttacttccacgagatt  17506700
                                                                 <-----------GT1
                                                               <---------AHL20(3)
                                                               <---------AHL12(2)
     <---------ANAC46                                          --------->AHL12(2)
--------AtLEC2                                                 --------->AHL20(3)
--------ANAC58                                               <---------CCA1(1)
--------ANAC58                                               <---------RVE1(1)
--->CCA1(2)                                                 <---------ARR11(3)
-->ARR14(2)                                                 --------->ARR11(3)
---ARR14(2)                                                 <---------RVE1(2)  <---------AHL20(3)
---GATA12                                                 ----------->ARR10    <---------AHL12(2)
-->GATA12                                                <--------P            --------->AHL12(2)
---RVE1(2)   --------->DAG2           --------->TOE2(3)----------->GT1         --------->AHL20(3) <-
---GLK1(2)  ---------->DOF2         <-------TEIL   <---------ZAT14           --------->ICU4  -------
 
tgcatgttttgtggataaagcttcttgcaccatgtaacatacattagccaatagtatagggtagatatttatcttttgacataattttcttcaaatttgt  17506800
 <---------YAB1                              <---------YAB5
<---------AHL20(2)                        --------->AHL25(1)
--------->AHL20(3)                        <---------AHL20(2)             --------->RAP2.6(2)
<---------AHL20(3)                        --------->AHL20(2)        ---------->DOF2<---------KAN1
--------->AHL12(3)              <---------DAG2                 --------->ARR11(3)  --------->KAN1
<---------AHL12(3)    --------->KAN1    <---------WOX13(2)     <---------ARR11(3)  --------->AHL12(1)
<---------AHL25(2)    <-----------GT1   --------->WOX13(2) ---------->DOF2<------NtERF2
--------YAB1       ----------->GT1  <-----------GT1 --------->ARR11(2) <---------At4g35610
---->GT1  <---------AHL12(1)    <----------DOF2     <---------ARR11(2) --------->At4g35610       <--
 
tatttttattcaaaaattcaaatagttactctctgcttttcacaattaatgagtgtatatactaaagacatttaagcggcaatggaatatttgttcaaat  17506900
                                                                                                <---
                                                                                               <----
                                                                                              <-----
                                                                                              <-----
                                                                                              ------
                                                                                             -------
                                                                                             -------
                                                                                             -------
                                                                                             -------
                                                                                            <-------
                                                                                            --------
                                                                                            --------
                                                                                            --------
                                                                                            --------
                                                                                            <------NtERF2
                                                                                           ------>NtERF2
                                                                                           <--------
                                                                                           ---------
                                                                                           ---------
                                                                                          <---------DEAR3(1)
                                                                                          <---------PCF2
                                                                                          <---------PCF5
                                --------->KAN1                                         <---------O2
                            ----------->GT1                                            --------->O2
                         ------>MYB83            <---------ANAC58                      =============
                         -------->P              <---------ANAC58                      --------->TGA1a
                         ------>MYB46(1) --------->LBD16  <---------AHL20(2)           <---------TGA1a
      <---------DEAR3(2) --------->MYB52(1) <---------KAN1--------->AHL25(3)          <---------LBD16
  <------MYB46(1)       ------>MYB46(1)  ----------->GT1<---------WOX13(2)           <---------ALFIN1
  <------MYB83          ------>MYB83<-----------GT1  ------------>CBF<---------ANAC46--------->MYB52(1)
 --------->MYB59        --------->MYB52(1) <---------MYB52(1)<-----------RAV1(1)    <------NtERF2
-------MYB46(3)      --------->ANAC46  <---------LBD16  --------->WOX13(2)          ----------->HVH21
 
tggttcggtcgattcagtttctaaacccaaccggtttattcacccggttatttcgagtcaatttatgtggttttgtggtctctgggcctcacggggccgc  17507000
------ALFIN1
--NtERF2
-NtERF2
----ATERF1(1)
>NtERF2
-->RAP2.6(2)
-->DEAR3(1)                                                          --------->GLK1(1)
-->RAP2.3(2)                                                         <---------GLK1(1)
-->RAP2.3(3)                                                         <---------At4g35610
--RAP2.6(2)                                                       --------->LBD16
->RAP2.3(1)                                ----------->HVH21    <---------LBD16
->ORA47(2)                        <-----------ARR10            --------->MYB52(1)
->ATERF1(1)                       --------->GATA12           --------->MYB46(3)                 ----
->DEAR4(2)                        --------->RVE1(2)          <---------ATHB12               <-------
-ATERF1(1)                        --------->GLK1(2)        --------->WOX13(1)               --------
>ATERF1(1)   --------->KAN1       <---------GATA12      --------->ANAC46                  <---------ZAT18
>ABI4(2)    <---------YAB5<----------DOF2  *TSS         --------->ANAC58                <-----------HVH21
=====================================bZIP_DOF           --------->ANAC58        <---------DOF5.7(1)
 
ctctccgtcttcatcaacattctcaaactcttttacaaatctaggctcgacgagggtttaagcaatcaccggagctcttagtctcttacgctgtgagcta  17507100
      <----------DOF2
      <---------DOF5.7(1)
     <---------DAG2
     <---------DOF5.7(1)
   ------>MYB46(1)
   ------>MYB83
 ----------->HVH21
 <---------MYB59                           --------->YAB1                               <-----------RAV1(1)
 --------->DEAR3(1)                        --------->YAB5                             <----------DOF2
--------->DEAR3(2)                       -------->P                         --------->ARR11(2)
--------->MYB46(3)                <---------ATHB12                          --------->ARR14(2)
------->ARR10       <----------DOF2    --------->MYB46(3)    --------->YAB5 <---------ARR14(2)
--At4g35610<---------ANAC58      --------->RVE1(2)          <---------YAB1  <---------ARR11(2)
->At4g35610<---------ANAC58     --------->WOX13(1)       ----------->TGA1  --------->KAN1
 
agaaccgaccttttgcttagtttctttcaagtctccaatcaaacaaccatgagagaaattgtgacgattcaagttggagaattcgcaaactttgttggct  17507200
                                                                       <---------RVE1(2)
              --------->LBD16       ------>ZmHOX2a(1)                  --------->ARR14(2)
             <-----------RAV1(2)  ----------->RAV1(2)   --------->GLK1(2)
         <---------KAN1      --------->ARR14(2)        <---------GLK1(2)--------->GLK1(2)
         --------->GLK1(1)   <---------ARR14(2)  <---------At4g35610   <---------GLK1(2)
    --------->HSFB2a(2) --------->ANAC58         <---------ZAT2<<<<<<<<<<<<<<<<<LFY
 <---------DAG2         --------->ANAC58         --------->At4g35610   <---------ARR14(2)
 <----------DOF2    <---------HSFB2a(2)          --------->ZAT2<-----------GT1                   <--
 
ctcacttttggaatttccaggttagagaagcaaaacctcctgttgaactctctgctccgattcttttaacaatggattctgggttttgtctgtctctgtt  17507300
                                                                                                   -
                                                                                               <----
                                                                                           <--------
                                                                                          <---------RVE1(2)
                                                                                          --------->ARR11(2)
                                                                                          <---------ARR11(2)
                                                                                          --------->ARR14(2)
                                                                                          <---------ARR14(2)
                                                                <---------ANAC58      <---------LBD16
                   <---------DOF5.7(1)          <---------TOE2(3)      <---------REM1(1)  --------->GATA12
                  <----------DOF2              ---------->DOF2  <---------ANAC58     <---------ANAC46
                 <---------DOF5.7(1)   <---------ANAC58    <----------DOF2           <---------ANAC58
      ---------->DOF2                  <---------ANAC58 --------->ARR11(3)           <---------ANAC58
---------GT1    ---------->ID1    --------->ATHB12      <---------ARR11(3)  <------ZmHOX2a(1)  <----
 
tttcattacaaaagtgtttgtcttttttgctataaatcgattgggtttgctaaagttgagaacttttacttgaaatgtaggatgaattgctcggattggc  17507400
                                                                                       --------->YAB5
                                                                                       --------->ATHB12
                                                                                      <---------YAB1
                                                                             --------->At4g35610
                                                                           <-----------RAV1(2)
                                 <---------ICU4                           <---------At4g35610
                    <---------DOF5.7(1)                                   <---------ZAT2 XXXXXXXXXXX
                    --------->YAB5                                        --------->ZAT2 <---------WOX13(1)
       ---------->DOF2        --------->TOE2(3) --------->KAN4(2)       <-----------RAV1(2)        <
---------->HVH21   <---------ATHB12           ------->TEIL      <-----------HVH21     --------->ICU4
-----ANAC58   <------ZmHOX2a(2)  <---------GLK1(2)        <---------At4g35610--------->ZAT2 <-------
-WOX13(1)    --------->GATA12 --------->YAB1  <---------RVE1(2)--------->LBD16      <---------At4g35610
-----ANAC58  <---------GATA12 --------->TOE1(3)--------->KAN1<---------LBD16 <---------At4g35610  <-
 
tagtgaccctgaaagcgatccaatctttagaaaccataatctcgacatggatgttctctaccgctccggtgagacccagcaggtgagagatgattgatat  17507500
<- Previous    Next ->

AGI:  At4g37190.1   
Description:  similar to Os03g0240900 [Oryza sativa (japonica cultivar-group)] (GB:NP_001049512.1); similar to Os12g0586400 [Oryza sativa (japonica cultivar-group)] (GB:NP_001067157.1); similar to hypothetical protein OsI_037654 [Oryza sativa (indica cultivar-group)] (GB:EAY83695.1); contains InterPro domain Tubulin/FtsZ, GTPase; (InterPro:IPR003008)
Range:  from: 17507044    to: 17509741    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version